Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7749

Mbp myelin basic protein ( MGI:96925)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7749 EMAGE:7749 EMAGE:7749 EMAGE:7749 EMAGE:7749
"Pseudo-wholemount" of euxassay_007522. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007522_01 euxassay_007522_02 euxassay_007522_03 euxassay_007522_04
EMAGE:7749 EMAGE:7749 EMAGE:7749 EMAGE:7749 EMAGE:7749
euxassay_007522_05 euxassay_007522_06 euxassay_007522_07 euxassay_007522_08 euxassay_007522_09
EMAGE:7749 EMAGE:7749 EMAGE:7749 EMAGE:7749 EMAGE:7749
euxassay_007522_10 euxassay_007522_11 euxassay_007522_12 euxassay_007522_13 euxassay_007522_14
EMAGE:7749 EMAGE:7749 EMAGE:7749 EMAGE:7749 EMAGE:7749
euxassay_007522_15 euxassay_007522_16 euxassay_007522_17 euxassay_007522_18 euxassay_007522_19
EMAGE:7749 EMAGE:7749 EMAGE:7749 EMAGE:7749
euxassay_007522_20 euxassay_007522_21 euxassay_007522_22 euxassay_007522_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7749Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7749_wholemount_strong.wlz
7749_wholemount_moderate.wlz
7749_wholemount_weak.wlz
7749_wholemount_possible.wlz
7749_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7749_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
mesenchyme
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata basal plate mantle layer
strong strong
spottedstrong expression: see section 12 13 14 15
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 08 19 weak expression: see section 07
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 07 08 09 18 19 20 21 22 23
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 09 18 19
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 08 18 19
basal columns
strong strong
spottedstrong expression: see section 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 10 11 12 13 17 18 19
brachial plexus
strong strong
regionalstrong expression: see section 05 06 07 08 09 19 20 21 22 23 moderate expression: see section 03 04 10
esophagus
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 15
left lung
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14
right lung
moderate moderate
regionalmoderate expression: see section 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3335
Entity Detected:Mbp, myelin basic protein ( MGI:96925)
Sequence:sense strand is shown

>T3335
TGGCCTCGAGCCAGATTCGGACGAGGATTCCCTGCCTCCTAGAAAGGACTCATTCTTAGCTTTAGGGGGG
TTCCTGTCACTGAATCGAGTCGCTGCCCTGGATGCAGGGCTGGCCTGGGCGACGCTCCAGGGATGAGGAG
CTGAGAACCCCAGTCTAATAATGTCCATCGACACCTCCTTATCCCTCTAACGTACTATGTCTTTTGATTT
AGCATGCCTTCTGTAGACCTTCCAAAGAGCCCCACACTGGCACCGTCACCCCTAGGAAGGCAGGTGATGG
TTGATGTAGCCCAATACTGCATCTTGTTAATCTGTTCTAACTCTGAGTAGAGTGTGGGTTTAAGATAACA
CCGATTAATGTATCGCCACAATAACGTGAGGGTAAGAGAAAAAGCAGGGAAGAAATTTCCAGAAAAAAAC
CCTCCAGATTGTCCCACGGGAGTGTTTGCCCTCCAGTGTGACTGAACGACCTTGCCCATGGCTTCGTCCA
GACAGCGCAGCTGCAGTATGGCTGGACAGAAGCACCTACTATTCTTGAATATTGAAATAAAA
Notes:The probe template was PCR amplified from IMAGE:315274 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:315274 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7748 same embryo
 EMAGE:7750 same embryo
 EMAGE:7747 same embryo
 EurExpress:euxassay_007522 same experiment
 MGI:4826122 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS