Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7877

Brd2 bromodomain containing 2 ( MGI:99495)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7877 EMAGE:7877 EMAGE:7877 EMAGE:7877 EMAGE:7877
"Pseudo-wholemount" of euxassay_012809. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012809_01 euxassay_012809_02 euxassay_012809_03 euxassay_012809_04
EMAGE:7877 EMAGE:7877 EMAGE:7877 EMAGE:7877 EMAGE:7877
euxassay_012809_05 euxassay_012809_06 euxassay_012809_07 euxassay_012809_08 euxassay_012809_09
EMAGE:7877 EMAGE:7877 EMAGE:7877 EMAGE:7877 EMAGE:7877
euxassay_012809_10 euxassay_012809_11 euxassay_012809_12 euxassay_012809_13 euxassay_012809_14
EMAGE:7877 EMAGE:7877 EMAGE:7877 EMAGE:7877 EMAGE:7877
euxassay_012809_15 euxassay_012809_16 euxassay_012809_17 euxassay_012809_18 euxassay_012809_19
EMAGE:7877 EMAGE:7877 EMAGE:7877 EMAGE:7877 EMAGE:7877
euxassay_012809_20 euxassay_012809_21 euxassay_012809_22 euxassay_012809_23 euxassay_012809_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7877Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7877_wholemount_strong.wlz
7877_wholemount_moderate.wlz
7877_wholemount_weak.wlz
7877_wholemount_possible.wlz
7877_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7877_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 06 07 08 16 17 18
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 09 15
facial vii ganglion
weak weak
regionalweak expression: see section 04 05 19 20
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 17
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 17 18 19 20 21 22
vagus x ganglion
weak weak
regionalweak expression: see section 07 08 16
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 09 14 15 16
mandible
weak weak
regionalweak expression: see section 05 06 07 08 09 14 15 16 17 18
lower jaw incisor
weak weak
regionalweak expression: see section 09 10 13 14
maxilla
weak weak
regionalweak expression: see section 08 09 16 17
upper jaw incisor
weak weak
regionalweak expression: see section 10 13 14 15
orbito-sphenoid
weak weak
regionalweak expression: see section 02 03 04 05 06 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38181
Entity Detected:Brd2, bromodomain containing 2 ( MGI:99495)
Sequence:sense strand is shown

>T38181
TAGTGATGAAGGCTCTGTGGAAGCATCAGTTTGCATGGCCATTCCGGCAGCCTGTGGACGCTGTGAAGCT
GGGTTTGCCGGATTATCACAAAATTATAAAACAGCCTATGGACATGGGTACTATCAAGAGGAGACTTGAA
AACAATTACTACTGGGCTGCCTCAGAATGTATGCAGGATTTTAATACTATGTTTACCAACTGTTACATTT
ATAACAAGCCCACCGATGATATTGTCCTAATGGCACAGACACTGGAAAAGATCTTCCTACAGAAAGTGGC
ATCCATGCCACAAGAGGAGCAAGAGCTTGTGGTGACCATCCCTAAAAACAGCCATAAGAAGGGGGGCAAG
TTAGCAGCACTCCAGGGCAGTATTACCAGTGCCCATCAGGTGCCTGCTGTCTCTTCTGTGTCGCATACAG
CCCTGTATACACCACCACCTGAAATACCTACCACTGTCCTCAACATTCCCCACCCATCAGTCATCTCTTC
TCCTCTTCTTAAGTCCCTGCATTCTGCTGGACCCCCACTCCTTGCTGTATCAGCAGCGCCTCCAGCTCAG
CCCCTTGCCAAGAAAAAAGGCGTTAAACGGAAAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 104182. Forward Primer - name:104182_F_cDNA_Brd2, sequence:TAGTGATGAAGGCTCTGTGGAA; Reverse Primer - name:104182_N_SP6_cDNA_Brd2, sequence:GCTTTCCGTTTAACGCCTTTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7881 same embryo
 EMAGE:7879 same embryo
 EMAGE:7880 same embryo
 EMAGE:7876 same embryo
 EMAGE:7878 same embryo
 EurExpress:euxassay_012809 same experiment
 MGI:4823501 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS