Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8044

Zfp462 zinc finger protein 462 ( MGI:107690)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8044 EMAGE:8044 EMAGE:8044 EMAGE:8044 EMAGE:8044
"Pseudo-wholemount" of euxassay_016001. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016001_01 euxassay_016001_02 euxassay_016001_03 euxassay_016001_04
EMAGE:8044 EMAGE:8044 EMAGE:8044 EMAGE:8044 EMAGE:8044
euxassay_016001_05 euxassay_016001_06 euxassay_016001_07 euxassay_016001_08 euxassay_016001_09
EMAGE:8044 EMAGE:8044 EMAGE:8044 EMAGE:8044 EMAGE:8044
euxassay_016001_10 euxassay_016001_11 euxassay_016001_12 euxassay_016001_13 euxassay_016001_14
EMAGE:8044 EMAGE:8044 EMAGE:8044 EMAGE:8044 EMAGE:8044
euxassay_016001_15 euxassay_016001_16 euxassay_016001_17 euxassay_016001_18 euxassay_016001_19
EMAGE:8044 EMAGE:8044 EMAGE:8044 EMAGE:8044 EMAGE:8044
euxassay_016001_20 euxassay_016001_21 euxassay_016001_22 euxassay_016001_23 euxassay_016001_24
EMAGE:8044
euxassay_016001_25

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8044Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8044_wholemount_strong.wlz
8044_wholemount_moderate.wlz
8044_wholemount_weak.wlz
8044_wholemount_possible.wlz
8044_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8044_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 04 05 20
head mesenchyme
weak weak
regionalweak expression: see section 01 02 03 23 24
submandibular gland primordium
weak weak
regionalweak expression: see section 06 07 08 09 16 17 18 19
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 17 moderate expression: see section 07 08 09 10 13 14 15 16 18
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 17 moderate expression: see section 09 10 11 12 13 14 15 16
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 17 moderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 18 19 20 21
pons mantle layer
strong strong
regionalstrong expression: see section 17 moderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 18 19
midbrain mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
facial vii ganglion
weak weak
regionalweak expression: see section 04 05 20 21
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 07 18
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 06 07 08 17 18 19
spinal cord mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 09 14 15 16 17 18
inner ear
weak weak
regionalweak expression: see section 03 04 05 06 07 09 16 17 18 19 20 21
pharyngo-tympanic tube
weak weak
regionalweak expression: see section 01 23 24 25
neural retina
weak weak
regionalweak expression: see section 01 02 03 04 23 24 25
mandible
weak weak
regionalweak expression: see section 03 04 05 06 19 20 21 22
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 14 15
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 18 19
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 12 14 15 16
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 19
metanephros
weak weak
regionalweak expression: see section 06 07 08 09 15 16 17 18 19
genital tubercle of male
moderate moderate
regionalmoderate expression: see section 10 11 13 weak expression: see section 12 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39595
Entity Detected:Zfp462, zinc finger protein 462 ( MGI:107690)
Sequence:sense strand is shown

>T39595
TGTCCTCTCTGCCTCTATCACACCAAATACAAACGCAACATGATCGACCACATAGTGCTGCACCGAGAAG
AGCGAGTTGTCCCCATTGAAGTGTGCCGTTCCAAACTGTCAAAATACTTGCAGGGAGTAGTTTTCCGCTG
TGATAAGTGTACCTTCACCTGCTCCAGTGACGAGAGTCTCCAGCAACACATAGAAAAGCACAATGAACTG
AAACCGTACAAATGCCAGCTCTGCTACTATGAGACCAAGCACACGGAGGAACTGGACACTCACCTTCGGG
ATGAGCACAAGGTGAGCCGGAACTTTGAGCTGGTTGGCCGGGTGAACTTGGATCAGCTGGAACAGATGAA
GGAGAAGATTGAGAGTTCCAGCAGCGAGGACGAGGACAAGGACGACGAAATGAGCAGCAAGGCTGAGGAC
AGAGAGCTGATGAGATTTGCAGACCGGGGGCCTGGTGTGAACACAGAGAAGCGATTTCCATGTGAATTCT
GTGGACGGGCGTTCTCACAGGGCTCTGAGTGGGAAAGACACGTGTTGAGACACGGCATGTCATTGCATGA
TACCAACCAAGTGAGCAGGAACGAAATCCATACAAAGGAGATGGTGGAGGAGAGTATGCAGCTGCCCTCC
ATAGAGGCCAAGGAAGACGATGAGCCAATTGGGATAGACTTTCCCTTAAAGAGCGAAACAGTAACCATCT
GTGTAGTGGCTGCCGACAAATCTCTCCTGGAGGATGCAGAGGCCAAAAACGAATAAGAGTTTGGTGAAAT
TCTTATCAAACCTTACTTGAACCGTGATGAAAATGTGGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 93334. Forward Primer - name:093334_F_cDNA_Zfp462, sequence:TGTCCTCTCTGCCTCTATCACA; Reverse Primer - name:093334_N_SP6_cDNA_Zfp462, sequence:CCCACATTTTCATCACGGTTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8047 same embryo
 EMAGE:8043 same embryo
 EMAGE:8045 same embryo
 EMAGE:8042 same embryo
 EMAGE:8046 same embryo
 EurExpress:euxassay_016001 same experiment
 MGI:4829312 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS