Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8279

Amigo2 adhesion molecule with Ig like domain 2 ( MGI:2145995)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8279 EMAGE:8279 EMAGE:8279 EMAGE:8279 EMAGE:8279
"Pseudo-wholemount" of euxassay_007618. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007618_01 euxassay_007618_02 euxassay_007618_03 euxassay_007618_04
EMAGE:8279 EMAGE:8279 EMAGE:8279 EMAGE:8279 EMAGE:8279
euxassay_007618_05 euxassay_007618_06 euxassay_007618_07 euxassay_007618_08 euxassay_007618_09
EMAGE:8279 EMAGE:8279 EMAGE:8279 EMAGE:8279 EMAGE:8279
euxassay_007618_10 euxassay_007618_11 euxassay_007618_12 euxassay_007618_13 euxassay_007618_14
EMAGE:8279 EMAGE:8279 EMAGE:8279 EMAGE:8279 EMAGE:8279
euxassay_007618_15 euxassay_007618_16 euxassay_007618_17 euxassay_007618_18 euxassay_007618_19
EMAGE:8279 EMAGE:8279 EMAGE:8279 EMAGE:8279 EMAGE:8279
euxassay_007618_20 euxassay_007618_21 euxassay_007618_22 euxassay_007618_23 euxassay_007618_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8279Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8279_wholemount_strong.wlz
8279_wholemount_moderate.wlz
8279_wholemount_weak.wlz
8279_wholemount_possible.wlz
8279_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8279_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
weak weak
regionalweak expression: see section 10 11 12 14 15
thalamus mantle layer
weak weak
regionalweak expression: see section 12
rest of cerebellum mantle layer
moderate moderate
spottedmoderate expression: see section 06 07 16 17 weak expression: see section 08 18
midbrain mantle layer
moderate moderate
spottedmoderate expression: see section 07 17 weak expression: see section 08 16
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 19 weak expression: see section 05 06 20
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 17 18 19 20 21
extraembryonic component
moderate moderate
spottedmoderate expression: see section 06
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35898
Entity Detected:Amigo2, adhesion molecule with Ig like domain 2 ( MGI:2145995)
Sequence:sense strand is shown

>T35898
ATCCAATAGGCTGAAGTCGGTAAAGAGTGCCACATTCCAAGAGCTGAAGGCTCTGGAAGTACTGCTGCTG
TACAACAACCACATTTCCTATCTGGACCCCGCAGCGTTCGGGGGGCTTTCCCACTTGCAGAAACTCTATC
TGAGTGGGAACTTTCTCACACAGTTCCCTATGGATTTGTATACTGGGAGGTTCAAGCTGGCTGATCTGAC
ATTTTTAGATGTTTCCTATAATCGAATCCCTTCCATACCGATGCACCATATAAACTTAGTGCCGGGGAGA
CAGCTGAGAGGCATCTACCTTCACGGGAACCCATTTGTATGTGACTGTTCTCTGTACTCGTTGCTGATCT
TTTGGTACCGTAGGCACTTTAGCTCCGTGATGGATTTTAAGAATGACTATACCTGTCGCCTGTGGTCTGA
CTCCAGGCACTCCCACCAGCTGCAGCTGCTCCAGGAGAGCTTTCTGAACTGTTCTTACAGCGTTATCAAC
GGCTCCTTCCACGCACTTGGCTTTATCCACGAGGCTCAGGTTGGGGAGAGGGCGATCGTCCACTGTGACA
GCAAGACTGGCAATGGAAATACTGATTTCATCTGGGTCGGTCCCGATAACAGGCTGCTGGAGCCAGATAA
AGACATGGGGAACTTTCGTGTGTTTTACAACGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 95969. Forward Primer - name:095969_F_cDNA_AI415330, sequence:ATCCAATAGGCTGAAGTCGGTA; Reverse Primer - name:095969_N_SP6_cDNA_AI415330, sequence:CCGTTGTAAAACACACGAAAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8280 same embryo
 EMAGE:8278 same embryo
 EMAGE:8277 same embryo
 EMAGE:8281 same embryo
 EurExpress:euxassay_007618 same experiment
 MGI:4823111 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS