Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8285

Angptl2 angiopoietin-like 2 ( MGI:1347002)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8285 EMAGE:8285 EMAGE:8285 EMAGE:8285 EMAGE:8285
"Pseudo-wholemount" of euxassay_007716. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007716_01 euxassay_007716_02 euxassay_007716_03 euxassay_007716_04
EMAGE:8285 EMAGE:8285 EMAGE:8285 EMAGE:8285 EMAGE:8285
euxassay_007716_05 euxassay_007716_06 euxassay_007716_07 euxassay_007716_08 euxassay_007716_09
EMAGE:8285 EMAGE:8285 EMAGE:8285 EMAGE:8285 EMAGE:8285
euxassay_007716_10 euxassay_007716_11 euxassay_007716_12 euxassay_007716_13 euxassay_007716_14
EMAGE:8285 EMAGE:8285 EMAGE:8285 EMAGE:8285 EMAGE:8285
euxassay_007716_15 euxassay_007716_16 euxassay_007716_17 euxassay_007716_18 euxassay_007716_19
EMAGE:8285 EMAGE:8285 EMAGE:8285 EMAGE:8285 EMAGE:8285
euxassay_007716_20 euxassay_007716_21 euxassay_007716_22 euxassay_007716_23 euxassay_007716_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8285Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8285_wholemount_strong.wlz
8285_wholemount_moderate.wlz
8285_wholemount_weak.wlz
8285_wholemount_possible.wlz
8285_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8285_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
pericardium
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22 23 24
diaphragm
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
upper arm mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 19 20 21 22 23 24
hand
strong strong
regionalstrong expression: see section 01 02 24
foot
strong strong
regionalstrong expression: see section 05 06 07 08 24
lower leg mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06
upper leg mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 10 21 22 23 24
mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
diencephalon meninges
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21
telencephalon meninges
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
hindbrain meninges
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
midbrain meninges
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
spinal cord meninges
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18
aorta
strong strong
regionalstrong expression: see section 11 12 13 14 15
heart valve
strong strong
regionalstrong expression: see section 10 11 12 13 14 15
mandible
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
maxilla
strong strong
regionalstrong expression: see section 09 10 11 17 18 19 20
axial skeleton
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
basioccipital bone
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 18 19 20 21 22 23 24
vault of skull
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07
clavicle
strong strong
regionalstrong expression: see section 07 08 09 10 15 16 17 18 19
sternum
strong strong
regionalstrong expression: see section 13 14
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 11 12 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35930
Entity Detected:Angptl2, angiopoietin-like 2 ( MGI:1347002)
Sequence:sense strand is shown

>T35930
TACCAGTCTCCCATCTTCCACTGATAAGCCATCAGGTCCATGGAGAGACTGCCTGCAAGCCCTGGAAGAT
GGTCACAGCACCAGCTCCATCTACCTGGTGAAGCCTGAGAATACCAACCGCCTGATGCAGGTGTGGTGTG
ACCAGAGACATGACCCTGGAGGTTGGACTGTCATCCAGAGACGCCTGGATGGCTCTGTCAACTTCTTCAG
GAACTGGGAGACCTATAAGCAAGGGTTTGGGAACATCGATGGTGAGTACTGGCTGGGCCTGGAGAACATC
TACTGGCTGACGAACCAAGGCAACTACAAACTGCTGGTAACCATGGAGGACTGGTCTGGCCGTAAAGTCT
TTGCTGAGTATGCCAGTTTCCGACTGGAGCCAGAAAGCGAGTACTATAAGCTGCGGCTGGGGCGTTATCA
TGGCAATGCAGGCGACTCCTTTACCTGGCACAACGGCAAACAGTTTACCACCCTGGACAGGGACCATGAT
GTCTACACAGGAAACTGTGCCCACTATCAGAAGGGAGGATGGTGGTATAACGCCTGTGCTCACTCCAACC
TCAATGGGGTCTGGTACCGTGGGGGCCATTACCGGAGCAGATACCAGGACGGGGTCTACTGGGCTGAGTT
CCGAGGAGGCTCTTACTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 94794. Forward Primer - name:094794_F_cDNA_Angptl2, sequence:TACCAGTCTCCCATCTTCCACT; Reverse Primer - name:094794_N_SP6_cDNA_Angptl2, sequence:GAGTAAGAGCCTCCTCGGAACT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8283 same embryo
 EMAGE:8286 same embryo
 EMAGE:8282 same embryo
 EMAGE:8284 same embryo
 EurExpress:euxassay_007716 same experiment
 MGI:4823124 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS