Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8354

Pdxp pyridoxal (pyridoxine, vitamin B6) phosphatase ( MGI:1919282)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8354 EMAGE:8354 EMAGE:8354 EMAGE:8354 EMAGE:8354
"Pseudo-wholemount" of euxassay_007702. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007702_01 euxassay_007702_02 euxassay_007702_03 euxassay_007702_04
EMAGE:8354 EMAGE:8354 EMAGE:8354 EMAGE:8354 EMAGE:8354
euxassay_007702_05 euxassay_007702_06 euxassay_007702_07 euxassay_007702_08 euxassay_007702_09
EMAGE:8354 EMAGE:8354 EMAGE:8354 EMAGE:8354 EMAGE:8354
euxassay_007702_10 euxassay_007702_11 euxassay_007702_12 euxassay_007702_13 euxassay_007702_14
EMAGE:8354 EMAGE:8354 EMAGE:8354 EMAGE:8354 EMAGE:8354
euxassay_007702_15 euxassay_007702_16 euxassay_007702_17 euxassay_007702_18 euxassay_007702_19
EMAGE:8354 EMAGE:8354 EMAGE:8354 EMAGE:8354 EMAGE:8354
euxassay_007702_20 euxassay_007702_21 euxassay_007702_22 euxassay_007702_23 euxassay_007702_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8354Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8354_wholemount_strong.wlz
8354_wholemount_moderate.wlz
8354_wholemount_weak.wlz
8354_wholemount_possible.wlz
8354_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8354_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 06 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 16 17 18 19 21 22 weak expression: see section 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 16 17 18 19
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 08 15
spinal cord
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 15
cervical ganglion
moderate moderate
regionalmoderate expression: see section 07 15 16
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 13 14
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 16 17 18 weak expression: see section 19
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36767
Entity Detected:Pdxp, pyridoxal (pyridoxine, vitamin B6) phosphatase ( MGI:1919282)
Sequence:sense strand is shown

>T36767
GTAGGCTACGACGAGCAGTTTTCCTTCTCCAGGTTGACCGAGGCGTGCGCGCACCTGCGCGACCCCGACT
GCCTGCTCGTGGCCACCGATCGCGACCCTTGGCACCCGCTCAGCGACGGAAGCCGGACCCCCGGTACTGG
AAGCCTGGCTGCCGCGGTGGAGACAGCCTCGGGACGCCAGGCCCTGGTGGTGGGCAAGCCCAGCCCTTAC
ATGTTCCAGTGCATCACAGAAGACTTCAGCGTGGACCCCGCCCGCACGCTGATGGTGGGGGACCGCCTGG
AGACCGACATACTCTTTGGCCACCGCTGCGGCATGACCACCGTGCTCACGCTCACGGGCGTCTCCAGCCT
CGAAGAAGCCCAGGCCTACCTGACGGCTGGCCAGCGTGACCTTGTGCCTCACTACTATGTGGAGAGCATT
GCGGACTTGATGGAGGGGCTGGAGGACTGAGCCCACCTCCCCTGTTGTTCCCTGATCCCACAGATGGAGG
CGACGGGCCATGAGTCACATTCGGGACCATGAGCTTTCTGGAGTGGGTGTCTGTACCCCAGTGAAGGGAG
GCTGGGATCCAGGAAGGTTTGTGGGCTTTCACACCCCCCTCCTAGCCGTGGCTGGACACTCTGCTCTTCA
GAAGCTGTCCCCCCACATCTTGAAGGTTCACCCTGGCCTGACCCCACCAGGTGGCCTTATTTCCTGCCCT
GTCACCTCCCTTCCTTGGGCCCCGAAGCCAAATGAAGATTTTTTTTTTTCCAACCTTTTAAGTTCCTCCC
ACTCTCTGGGATCTCTAGTGCTCTGTCCCTAGAGATTGTTGGCCAATCAGAGATCTAGGGAACTCCAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 96724. Forward Primer - name:096724_F_cDNA_Pdxp, sequence:GTAGGCTACGACGAGCAGTTTT; Reverse Primer - name:096724_N_SP6_cDNA_Pdxp, sequence:GCTGGAGTTCCCTAGATCTCTGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8352 same embryo
 EMAGE:8357 same embryo
 EMAGE:8353 same embryo
 EMAGE:8356 same embryo
 EMAGE:8355 same embryo
 EurExpress:euxassay_007702 same experiment
 MGI:4827141 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS