Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8452

Rasl11b RAS-like, family 11, member B ( MGI:1916189)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8452 EMAGE:8452 EMAGE:8452 EMAGE:8452 EMAGE:8452
"Pseudo-wholemount" of euxassay_009650. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009650_01 euxassay_009650_02 euxassay_009650_03 euxassay_009650_04
EMAGE:8452 EMAGE:8452 EMAGE:8452 EMAGE:8452 EMAGE:8452
euxassay_009650_05 euxassay_009650_06 euxassay_009650_07 euxassay_009650_08 euxassay_009650_09
EMAGE:8452 EMAGE:8452 EMAGE:8452 EMAGE:8452 EMAGE:8452
euxassay_009650_10 euxassay_009650_11 euxassay_009650_12 euxassay_009650_13 euxassay_009650_14
EMAGE:8452 EMAGE:8452 EMAGE:8452 EMAGE:8452 EMAGE:8452
euxassay_009650_15 euxassay_009650_16 euxassay_009650_17 euxassay_009650_18 euxassay_009650_19
EMAGE:8452 EMAGE:8452 EMAGE:8452 EMAGE:8452 EMAGE:8452
euxassay_009650_20 euxassay_009650_21 euxassay_009650_22 euxassay_009650_23 euxassay_009650_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8452Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8452_wholemount_strong.wlz
8452_wholemount_moderate.wlz
8452_wholemount_weak.wlz
8452_wholemount_possible.wlz
8452_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8452_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
forearm mesenchyme
weak weak
regionalweak expression: see section 01 02
hand mesenchyme
weak weak
regionalweak expression: see section 01 02 03 04 05 06 23 24
hindlimb digit 1 mesenchyme
weak weak
regionalweak expression: see section 03 04 20 21 22
hindlimb digit 2 mesenchyme
weak weak
regionalweak expression: see section 03 04 19 20 21 22
hindlimb digit 3 mesenchyme
weak weak
regionalweak expression: see section 03 04 19 20 21 22
hindlimb digit 4 mesenchyme
weak weak
regionalweak expression: see section 03 04 19 20 21 22
hindlimb digit 5 mesenchyme
weak weak
regionalweak expression: see section 03 04 19 20 21
foot mesenchyme
weak weak
regionalweak expression: see section 01 02 23
lower leg mesenchyme
weak weak
regionalweak expression: see section 01 02 23 24
axial muscle
weak weak
regionalweak expression: see section 01 02 03 04 05 06 21 22 23 24
cranial muscle
weak weak
regionalweak expression: see section 01 02 03 04 05 21 22 23 24
vibrissa
weak weak
regionalweak expression: see section 04 05 06 19 20 21
saccule
weak weak
regionalweak expression: see section 07 08 19
cochlea
weak weak
regionalweak expression: see section 17 18
lens
strong strong
regionalstrong expression: see section 01
nasal septum
weak weak
regionalweak expression: see section 12 13 14 15 16
viscerocranium
weak weak
regionalExpression in the turbinate bone.
lung
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 10 11 17 18 19 20 21 22 23 weak expression: see section 03 09 14 15 16 24
pelvic girdle skeleton
weak weak
regionalweak expression: see section 07 08 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36948
Entity Detected:Rasl11b, RAS-like, family 11, member B ( MGI:1916189)
Sequence:sense strand is shown

>T36948
CTATTCAGGTCCAGGACACTCCGGGCATCCAGGTGCACGAGAATGGCTTGAGTTGCAGCGAGCAGTTGAA
TCGCTGCATTCGCTGGGCAGATGCCGTCGTCCTCGTGTTCTCCATCACGGACCACAAGAGCTACGAACTC
ATTAGCCAGCTCCACCAGCACGTGCAGCAGCTGCACCCGGGCACTCGGCTGCCTGTGGTGTTGGTGGCTA
ACAAAGCTGACCTCCTACACGTCAAGCAGGTGGACCCTCAGCTTGGCCTGCAACTGGCCAGCATGCTCGG
CTGCTCCTTCTATGAAGTATCTGTCAGTGAAAATTACAACGACGTCTACAATGCTTTCCATGTCCTGTGC
AAAGAAGTGAGCCCCAAGCAGCAGCCCAGCAGCACCCCCGAGAAACGCAGAACTTCCCTCATCCCCAGAC
CCAAGTCGCCCAACATGCAAGACCTGAAGAGGAGGTTTAAGCAGGCTCTGTCTGCCAAAGTGAGGACTGT
CACGTCGGTCTGAGGCACGACTCCTGGAGGGGGTTTGGTCTTCTGGGCAGAAAGCCCGAGGTTCTTCTTA
GATGGGACCATGGCAGGCTGACAGCAGTTATGGTTCCAGAAAGAGCAGTGGCAGAGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 78763. Forward Primer - name:078763_F_cDNA_Rasl11b, sequence:CTATTCAGGTCCAGGACACTCC; Reverse Primer - name:078763_N_SP6_cDNA_Rasl11b, sequence:CCTCTGCCACTGCTCTTTCTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8454 same embryo
 EMAGE:8455 same embryo
 EMAGE:8451 same embryo
 EMAGE:8453 same embryo
 EMAGE:8450 same embryo
 EurExpress:euxassay_009650 same experiment
 MGI:4827632 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS