Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8511

Acox1 acyl-Coenzyme A oxidase 1, palmitoyl ( MGI:1330812)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8511 EMAGE:8511 EMAGE:8511 EMAGE:8511 EMAGE:8511
"Pseudo-wholemount" of euxassay_009754. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009754_01 euxassay_009754_02 euxassay_009754_03 euxassay_009754_04
EMAGE:8511 EMAGE:8511 EMAGE:8511 EMAGE:8511 EMAGE:8511
euxassay_009754_05 euxassay_009754_06 euxassay_009754_07 euxassay_009754_08 euxassay_009754_09
EMAGE:8511 EMAGE:8511 EMAGE:8511 EMAGE:8511 EMAGE:8511
euxassay_009754_10 euxassay_009754_11 euxassay_009754_12 euxassay_009754_13 euxassay_009754_14
EMAGE:8511 EMAGE:8511 EMAGE:8511 EMAGE:8511 EMAGE:8511
euxassay_009754_15 euxassay_009754_16 euxassay_009754_17 euxassay_009754_18 euxassay_009754_19
EMAGE:8511 EMAGE:8511 EMAGE:8511 EMAGE:8511 EMAGE:8511
euxassay_009754_20 euxassay_009754_21 euxassay_009754_22 euxassay_009754_23 euxassay_009754_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8511Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8511_wholemount_strong.wlz
8511_wholemount_moderate.wlz
8511_wholemount_weak.wlz
8511_wholemount_possible.wlz
8511_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8511_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal medulla
weak weak
regionalweak expression: see section 07 08 09 15 16
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 14
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 18
facial vii ganglion
weak weak
regionalweak expression: see section 04
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22
vagus x ganglion
weak weak
regionalweak expression: see section 07 17 18
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 09 10 11 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30610
Entity Detected:Acox1, acyl-Coenzyme A oxidase 1, palmitoyl ( MGI:1330812)
Sequence:sense strand is shown

>T30610
TCGAGGGGGAGAACACTGTTATGATGCTGCAGACGGCCAGGTTCTTGATGAAAATCTATGACCAGGTTCA
GTCGGGGAAGCTGGTGGGTGGTATGGTGTCGTACTTGAATGACCTGCCGAGCCAGCGTATCCAGCCGCAG
CAGGTGGCAGTCTGGCCAACTCTGGTGGACATTAACAGCCTGGACAGCCTGACAGAAGCCTACAAGCTAC
GTGCAGCCAGATTGGTAGAAATTGCTGCAAAAAACCTTCAGGCCCAAGTGAGTCACAGGAAGAGCAAGGA
AGTGGCGTGGAACTTGACTTCTGTCGACCTTGTTCGCGCAAGTGAGGCGCACTGCCACTACGTGACCGTT
AAGGTCTTTGCAGATAAACTCCCCAAGATTCAAGACAGAGCCGTGCAAGCCGTGCTGAGGAACCTGTGTC
TCTTATATTCTCTCTATGGGATCAGCCAGAAAGGAGGGGATTTTCTTGAGGGGAACATCATCACAGGGGC
TCAGATGTCACAGGTAAACAGTCGGATCCTGGAGCTGCTCACAGTGACTCGCCCCAACGCTGTGGCTTTG
GTGGATGCCTTTGACTTTAAGGATGTGACCCTTGGCTCTGTTCTCGGCCGCTATGATGGCAATGTGTATG
AAAACTTGTTTGAGTGGGCCAAGAAGTCCCCACTGAACAAGACAGAGGTCCACGAATCTTACTACAAGCA
CTTGAAGCCCCTGCAGTCGAAGCTTTGAAGTTTCCCCAGGGACAAGTCTGAGCTCCACAGAGAGGCCGAA
TCTCTCCTTGATTCACTAATCCTTGTGAAATCGTCTTCAGACTTGTGTAGCTATAGAGCAAATGATGGGC
TG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5704873), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59702. Forward Primer - name:059702_F_IRAV114_h10_Acox1, sequence:TCGAGGGGGAGAACACTG; Reverse Primer - name:059702_R_SP6_IRAV114_h10_Acox1, sequence:CCAGCCCATCATTTGCTC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8513 same embryo
 EMAGE:8512 same embryo
 EMAGE:8509 same embryo
 EMAGE:8508 same embryo
 EMAGE:8510 same embryo
 EurExpress:euxassay_009754 same experiment
 MGI:4822930 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS