Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8557

Cnn3 calponin 3, acidic ( MGI:1919244)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8557 EMAGE:8557 EMAGE:8557 EMAGE:8557 EMAGE:8557
"Pseudo-wholemount" of euxassay_009765. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009765_01 euxassay_009765_02 euxassay_009765_03 euxassay_009765_04
EMAGE:8557 EMAGE:8557 EMAGE:8557 EMAGE:8557 EMAGE:8557
euxassay_009765_05 euxassay_009765_06 euxassay_009765_07 euxassay_009765_08 euxassay_009765_09
EMAGE:8557 EMAGE:8557 EMAGE:8557 EMAGE:8557 EMAGE:8557
euxassay_009765_10 euxassay_009765_11 euxassay_009765_12 euxassay_009765_13 euxassay_009765_14
EMAGE:8557 EMAGE:8557 EMAGE:8557 EMAGE:8557 EMAGE:8557
euxassay_009765_15 euxassay_009765_16 euxassay_009765_17 euxassay_009765_18 euxassay_009765_19
EMAGE:8557 EMAGE:8557 EMAGE:8557 EMAGE:8557
euxassay_009765_20 euxassay_009765_21 euxassay_009765_22 euxassay_009765_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8557Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8557_wholemount_strong.wlz
8557_wholemount_moderate.wlz
8557_wholemount_weak.wlz
8557_wholemount_possible.wlz
8557_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8557_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
body cavity or lining
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
limb
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22 23
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
gland
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
alimentary system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
nervous system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
integumental system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
sensory organ system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
cardiovascular system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
urinary system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
reproductive system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
respiratory system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
tail
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30642
Entity Detected:Cnn3, calponin 3, acidic ( MGI:1919244)
Sequence:sense strand is shown

>T30642
CCAGGTTCAGACGACGCTGGTGGCTCTAGCAGGTCTGGCGAAAACAAAAGGATTCCATACAACCATTGAC
ATTGGCGTTAAGTATGCAGAAAAACAAACAAGACGTTTTGATGAAGGCAAATTAAAGGCTGGCCAGAGTG
TAATTGGTTTACAGATGGGTACCAACAAATGTGCCAGCCAGGCGGGCATGACAGCCTATGGGACTCGGAG
GCATCTTTATGATCCCAAGATGCAGACGGACAAACCCTTTGACCAGACCACGATTAGCCTGCAGATGGGC
ACCAACAAAGGGGCCAGCCAGGCTGGGATGTTAGCACCGGGCACCAGAAGAGACATCTATGACCAGAAGC
TGACATTACAGCCAGTGGACAACTCGACCATTTCTCTACAGATGGGCACCAACAAAGTTGCTTCCCAGAA
AGGAATGAGCGTGTATGGGCTTGGGCGGCAAGTATATGACCCCAAGTACTGTGCCGCACCCACAGAACCT
GTCATTCACAACGGAAGCCAGGGCACGGGCACCAATGGGTCGGAAATCAGTGATAGCGATTATCAGGCAG
AATACCCCGATGAATATCATGGCGAGTACCCAGACGACTACCCTCGGGAGTACCAGTATGGCGACGACCA
GGGCATTGATTATTAGAGTCACACACAGGAGCGCAGTATTTAGTCCATTGTTTTATCCAGTGAGACCCAA
GCTAGCCTTGAATAATTCTTCTCTCGTCTTCCTGAAACACTATTATGCTTGTTGTACCTTTAAAGTATGC
CTTATGTACATTCCTTTCTCCTTTTCCTGCCTCCTCCCTAAATAGCTGCCTTCTAGTGCTGTAGCAAGGG
AGCCCTACTGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6415164), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59589. Forward Primer - name:059589_F_IRAV116_b11_Cnn3, sequence:CCAGGTTCAGACGACGCT; Reverse Primer - name:059589_R_SP6_IRAV116_b11_Cnn3, sequence:TGCAGTAGGGCTCCCTTG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8556 same embryo
 EMAGE:8558 same embryo
 EMAGE:8554 same embryo
 EMAGE:8555 same embryo
 EurExpress:euxassay_009765 same experiment
 MGI:4823955 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS