Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8633

Hras1 Harvey rat sarcoma virus oncogene 1 ( MGI:96224)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8633 EMAGE:8633 EMAGE:8633 EMAGE:8633 EMAGE:8633
"Pseudo-wholemount" of euxassay_009828. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009828_01 euxassay_009828_02 euxassay_009828_03 euxassay_009828_04
EMAGE:8633 EMAGE:8633 EMAGE:8633 EMAGE:8633 EMAGE:8633
euxassay_009828_05 euxassay_009828_06 euxassay_009828_07 euxassay_009828_08 euxassay_009828_09
EMAGE:8633 EMAGE:8633 EMAGE:8633 EMAGE:8633 EMAGE:8633
euxassay_009828_10 euxassay_009828_11 euxassay_009828_12 euxassay_009828_13 euxassay_009828_14
EMAGE:8633 EMAGE:8633 EMAGE:8633 EMAGE:8633 EMAGE:8633
euxassay_009828_15 euxassay_009828_16 euxassay_009828_17 euxassay_009828_18 euxassay_009828_19
EMAGE:8633 EMAGE:8633 EMAGE:8633 EMAGE:8633 EMAGE:8633
euxassay_009828_20 euxassay_009828_21 euxassay_009828_22 euxassay_009828_23 euxassay_009828_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8633Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8633_wholemount_strong.wlz
8633_wholemount_moderate.wlz
8633_wholemount_weak.wlz
8633_wholemount_possible.wlz
8633_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8633_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
strong strong
regionalstrong expression: see section 06 07 09 16 17 18 moderate expression: see section 08 19
vibrissa
moderate moderate
regionalmoderate expression: see section 04 05 06 17 18 19 20
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 16 17
pons mantle layer
weak weak
regionalweak expression: see section 08 18
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 18 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 16 17 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08
ventral grey horn
strong strong
regionalstrong expression: see section 08 10 12 15 moderate expression: see section 09 11 13 weak expression: see section 14
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 12 13 14 15 16 17
neural retina
weak weak
regionalweak expression: see section 01 02 22 23 24
naris
weak weak
regionalweak expression: see section 09 10 11 12 13 14
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 07 08 09 10 13 14 15
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 09 10 13 14
lower jaw molar
weak weak
regionalweak expression: see section 06 07 17 18
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 09 10 13 14
upper jaw molar
weak weak
regionalweak expression: see section 06 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30875
Entity Detected:Hras1, Harvey rat sarcoma virus oncogene 1 ( MGI:96224)
Sequence:sense strand is shown

>T30875
CTCGCAGCTATGGCATCCCCTACATTGAAACATCAGCCAAGACCCGGCAGGGCGTGGAGGATGCCTTCTA
TACACTAGTCCGTGAGATTCGGCAGCATAAATTGCGGAAACTGAACCCACCCGATGAGAGTGGTCCTGGC
TGCATGAGCTGCAAATGTGTGCTGTCCTGACACCAGGTGAGGCAGGGACCAGCGAGACGTCTGGGGCAGT
GACCTCAGCTAGCCAGATGAACTTCATATCCACTCTGATGTCCTTGCTCCCCCAATTCTGCCAATCCCCC
CCGCCTGCAGTCAGTCATGTCCTTTGTGCCCGTCCCGGCACAGGCTCAGGACATGGAGGTGCCGGATGCA
GGGAGGAGGTGCCGACGGAAGGAAGGAAAGAGGCGGGAAGGAAGGAAACGGTGCTGGAGCCAGGCCAGTC
CAGGGATGGTGGACAGATGTGACCAAGACCTTCGCATGGACAATTTGAACAGACTGTCATGAACTGTCCC
TGTTGCCACTGGCACCCAAGTCCTCCACCCCTCTCAGTTCCCTCCGGGCGCCTGCCTGTGAGGGCACACG
TT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3152667), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 19790. Forward Primer - name:019790_F_IRAV24-27_G03_Hras1, sequence:CTCGCAGCTATGGCATCC; Reverse Primer - name:019790_R_SP6_IRAV24-27_G03_Hras1, sequence:CAACGTGTGCCCTCACAG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8631 same embryo
 EMAGE:8630 same embryo
 EMAGE:8634 same embryo
 EMAGE:8632 same embryo
 EMAGE:8635 same embryo
 EurExpress:euxassay_009828 same experiment
 MGI:4825450 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS