Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8785

Prkci protein kinase C, iota ( MGI:99260)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8785 EMAGE:8785 EMAGE:8785 EMAGE:8785 EMAGE:8785
"Pseudo-wholemount" of euxassay_009982. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009982_01 euxassay_009982_02 euxassay_009982_03 euxassay_009982_04
EMAGE:8785 EMAGE:8785 EMAGE:8785 EMAGE:8785 EMAGE:8785
euxassay_009982_05 euxassay_009982_06 euxassay_009982_07 euxassay_009982_08 euxassay_009982_09
EMAGE:8785 EMAGE:8785 EMAGE:8785 EMAGE:8785 EMAGE:8785
euxassay_009982_10 euxassay_009982_11 euxassay_009982_12 euxassay_009982_13 euxassay_009982_14
EMAGE:8785 EMAGE:8785 EMAGE:8785 EMAGE:8785 EMAGE:8785
euxassay_009982_15 euxassay_009982_16 euxassay_009982_17 euxassay_009982_18 euxassay_009982_19
EMAGE:8785 EMAGE:8785 EMAGE:8785 EMAGE:8785 EMAGE:8785
euxassay_009982_20 euxassay_009982_21 euxassay_009982_22 euxassay_009982_23 euxassay_009982_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8785Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8785_wholemount_strong.wlz
8785_wholemount_moderate.wlz
8785_wholemount_weak.wlz
8785_wholemount_possible.wlz
8785_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8785_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 11 12 13 14 15
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 16 17 18
anterior naris epithelium
moderate moderate
regionalmoderate expression: see section 08 09 11 12 13
external naris epithelium
moderate moderate
regionalmoderate expression: see section 08 12 13
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 12 13 14 15 16 17
pharynx epithelium
moderate moderate
regionalmoderate expression: see section 13
tongue epithelium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15
stomach
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07
midgut
moderate moderate
regionalmoderate expression: see section 11 12 13 14 17 18 weak expression: see section 15 16
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 18
oral epithelium
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 09 13
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 18
bladder
moderate moderate
regionalmoderate expression: see section 12 13
urethra of male
moderate moderate
regionalmoderate expression: see section 13 14
left lung
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12
right lung
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19 20 21 22 23
trachea
moderate moderate
regionalmoderate expression: see section 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31148
Entity Detected:Prkci, protein kinase C, iota ( MGI:99260)
Sequence:sense strand is shown

>T31148
AACCAGCACTTTCTGCGGCACTCCCAATTACATTGCTCCAGAGATCTTAAGAGGAGAAGATTATGGCTTC
AGCGTTGACTGGTGGGCTCTTGGAGTGCTTATGTTTGAGATGATGGCGGGAAGGTCTCCGTTTGATATCG
TTGGGAGCTCTGACAATCCTGACCAAAACACAGAGGATTATCTATTCCAAGTCATTTTGGAAAAGCAGAT
CCGCATCCCGCGTTCTCTGTCTGTAAAAGCAGCAAGTGTACTGAAGAGTTTTCTCAACAAGGACCCAAAG
GAACGATTGGGTTGTCACCCTCAAACTGGATTTGCTGACATTCAAGGACATCCATTCTTCAGAAATGTGG
ACTGGGACATGATGGAGCAAAAGCAGGTGGTTCCACCCTTTAAACCAAACATTTCTGGAGAATTTGGTTT
GGATAATTTCGATTCTCAGTTTACTAATGAACCAGTCCAGCTCACTCCAGATGATGATGACATTGTGAGG
AAGATTGATCAGTCTGAATTTGAAGGTTTTGAGTATATCAACCCCCTCTTGATGTCTGCAGAAGAGTGTG
TCTGATTCTGCTTGCCGCCATTCAGTGCATGGATATCCACCCGTCAGCCTGCTCACAGTTAGCATTTTAT
GTTGCCCCTGCAGAAGTCGCTCTCGGTATCCTGTTGGAGACTAGGAATCATACAGATAAATAGAACTAAG
AAACAGAAGCTAGCTTCCTGACAATCATGTCGACCCTGCTTATGCTTGCTCTCCAGACACTCCTAATGAG
GAAGGACGGTCTTTGTGTAAAGGAAACAACACAGCTTGTCAAAGAAAGCCTCTGCTGCGTTGTGACACTC
GAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3980628), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 53278. Forward Primer - name:053278_F_IRAV44_f02_Prkci, sequence:AACCAGCACTTTCTGCGG; Reverse Primer - name:053278_R_SP6_IRAV44_f02_Prkci, sequence:CGTCGAGTGTCACAACGC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8786 same embryo
 EurExpress:euxassay_009982 same experiment
 MGI:4827423 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS