Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8811

Dbc1 deleted in bladder cancer 1 (human) ( MGI:1928478)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8811 EMAGE:8811 EMAGE:8811 EMAGE:8811 EMAGE:8811
"Pseudo-wholemount" of euxassay_010001. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010001_01 euxassay_010001_02 euxassay_010001_03 euxassay_010001_04
EMAGE:8811 EMAGE:8811 EMAGE:8811 EMAGE:8811 EMAGE:8811
euxassay_010001_05 euxassay_010001_06 euxassay_010001_07 euxassay_010001_08 euxassay_010001_09
EMAGE:8811 EMAGE:8811 EMAGE:8811 EMAGE:8811 EMAGE:8811
euxassay_010001_10 euxassay_010001_11 euxassay_010001_12 euxassay_010001_13 euxassay_010001_14
EMAGE:8811 EMAGE:8811 EMAGE:8811 EMAGE:8811 EMAGE:8811
euxassay_010001_15 euxassay_010001_16 euxassay_010001_17 euxassay_010001_18 euxassay_010001_19
EMAGE:8811 EMAGE:8811 EMAGE:8811 EMAGE:8811 EMAGE:8811
euxassay_010001_20 euxassay_010001_21 euxassay_010001_22 euxassay_010001_23 euxassay_010001_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8811Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8811_wholemount_strong.wlz
8811_wholemount_moderate.wlz
8811_wholemount_weak.wlz
8811_wholemount_possible.wlz
8811_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8811_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 06 07 08 09 16 17 18 19
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14 15 weak expression: see section 07 08
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14 15 16 17 weak expression: see section 07 08 12
cerebral cortex marginal layer
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 19 20 21 weak expression: see section 02 03 04
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 10 11 weak expression: see section 12 15 16 17 18
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 13 14 15 16 17
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 05 07 09 10 12 13 16 17 18 weak expression: see section 04 06 19
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 05 08 09 10 11 13 14 15 16 17 18 weak expression: see section 06 07
glossopharyngeal ix ganglion
strong strong
single cellstrong expression: see section 07 17
trigeminal v ganglion
strong strong
single cellstrong expression: see section 02 03 04 05 06 07 08 16 17 18 19 20 21
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 17 weak expression: see section 05 16
dorsal grey horn
moderate moderate
regionalmoderate expression: see section 06 07 08 10 11 13 weak expression: see section 09 12
ventral grey horn
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 weak expression: see section 13
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 11 moderate expression: see section 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31747
Entity Detected:Dbc1, deleted in bladder cancer 1 (human) ( MGI:1928478)
Sequence:sense strand is shown

>T31747
CTGTTTGTATGGGGCCGTATCTCAGTGCAGCCCTCCCGCCAGGAGCCAGCTGGGACAGACCAACATGTCT
CCAAGGAATTTGATTGGCTTATTTCAGACAGGGGGCCTTTCCACCACTCCAGGAGCTACCTATCCTTTGT
GGAAAGACACCGGCAAGGATTTACAACCAGATATAAAATATACAGGGAGTTTGCCCGTTGGAAGGTGAGG
AACACAGCCATAGAAAGGAGAGACCTGGTCCGTCACCCAGTGCCCCTCATGCCGGAGTTTCAAAGGAGCA
TCCGTCTGCTTGGCAGGAGACCCACCACTCAGCAGTTCATTGATACCATCATCAAAAAGTACGGCACCCA
CCTGCTCATCTCTGCTACATTGGGAGGAGAGGAGGCTTTGACCATGTACATGGACAAAAGTCGCCTGGAC
CGGAAGTCAGGGAATGCTACCCAAAGTGTTGAAGCTTTGCACCAGCTTGCATCATCCTACTTTGTCGACC
GTGATGGCACCATGAGAAGGCTCCATGAGATCCAGATTTCAACTGGAGCAATCAAGGTCACAGAAACACG
CACTGGGCCTCTGGGCTGTAACAGCTATGACAATCTGGACTCTGTGAGTTCTGTCCTTCTGCAAAGCACG
GAGAGCAAACTGCACCTTCAAGGTCTTCAGATAATCTTCCCGCAGTATCTGCAAGAGAAGTTTGTTCAGT
CGGCCTTGAGTTACATCATGTGCAATGGAGAGGGAGAGTATGTGTGTCAGAACAGCCAGTGTCGCTGCCA
GTGTGCTGAGGAGTTCCCACAGTGCAACTGCCCCATCACCGACATCCAGATCATGGAGTTTACGCTGGCA
AACATG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6494212), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58077. Forward Primer - name:058077_F_IRAV91_h12_Dbccr1, sequence:CTGTTTGTATGGGGCCGT; Reverse Primer - name:058077_R_SP6_IRAV91_h12_Dbccr1, sequence:CCATGTTTGCCAGCGTAA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8812 same embryo
 EMAGE:8813 same embryo
 EMAGE:8810 same embryo
 EMAGE:8814 same embryo
 EurExpress:euxassay_010001 same experiment
 MGI:4824237 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS