Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8840

Rgs2 regulator of G-protein signaling 2 ( MGI:1098271)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8840 EMAGE:8840 EMAGE:8840 EMAGE:8840 EMAGE:8840
"Pseudo-wholemount" of euxassay_012997. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012997_01 euxassay_012997_02 euxassay_012997_03 euxassay_012997_04
EMAGE:8840 EMAGE:8840 EMAGE:8840 EMAGE:8840 EMAGE:8840
euxassay_012997_05 euxassay_012997_06 euxassay_012997_07 euxassay_012997_08 euxassay_012997_09
EMAGE:8840 EMAGE:8840 EMAGE:8840 EMAGE:8840 EMAGE:8840
euxassay_012997_10 euxassay_012997_11 euxassay_012997_12 euxassay_012997_13 euxassay_012997_14
EMAGE:8840 EMAGE:8840 EMAGE:8840 EMAGE:8840 EMAGE:8840
euxassay_012997_15 euxassay_012997_16 euxassay_012997_17 euxassay_012997_18 euxassay_012997_19
EMAGE:8840 EMAGE:8840 EMAGE:8840 EMAGE:8840 EMAGE:8840
euxassay_012997_20 euxassay_012997_21 euxassay_012997_22 euxassay_012997_23 euxassay_012997_24
EMAGE:8840
euxassay_012997_25

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8840Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8840_wholemount_strong.wlz
8840_wholemount_moderate.wlz
8840_wholemount_weak.wlz
8840_wholemount_possible.wlz
8840_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8840_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal gland
weak weak
regionalweak expression: see section 07 08 09 15 16 17
pituitary gland
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17
pineal primordium
strong strong
regionalstrong expression: see section 13
olfactory cortex mantle layer
strong strong
regionalstrong expression: see section 12 moderate expression: see section 16
medulla oblongata floor plate
strong strong
regionalstrong expression: see section 13
metencephalon floor plate
strong strong
regionalstrong expression: see section 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38863
Entity Detected:Rgs2, regulator of G-protein signaling 2 ( MGI:1098271)
Sequence:sense strand is shown

>T38863
AGGAGAGGCTCTGTGTGAGAACGGCTTCCCTCACTGTGTGAAGAACAGAGGGAGGGAACAGGCCTCTGAA
TGTGTTCTTCCTCCTTGTCGGGAAAGCAGAGTTTGAGATGAAAGATCCGATGCAATGTTGTTGGAGCATT
TAAAATCAATAGGTCTGGGATTATGTGGCCTTAGCTAGTTGGCTGTACACCTTCCCTAAACTAGTCCATG
TTACCACATAGTGGTGTTAGTTCTAGTTTTAATATTTTAGTACTAAGTAACATTACAATGTTTACTGTGT
GCAAGGGTGTTGACGTTCTTAGGACTACAGATCATTAGTACTAGTGTGTCACGTATCACTGAAACTGAGA
AGTATGTTTGAGTTGTTAAATGGTGTGTGTGATGGACCGAATG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 177431. Forward Primer - name:177431_F_cDNA_Rgs2, sequence:AGGAGAGGCTCTGTGTGAGAAC; Reverse Primer - name:177431_N_SP6_cDNA_Rgs2, sequence:CATTCGGTCCATCACACACAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8839 same embryo
 EMAGE:8842 same embryo
 EMAGE:8841 same embryo
 EMAGE:8838 same embryo
 EMAGE:8837 same embryo
 EurExpress:euxassay_012997 same experiment
 MGI:4827719 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS