Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9022

Abcc8 ATP-binding cassette, sub-family C (CFTR/MRP), member 8 ( MGI:1352629)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9022 EMAGE:9022 EMAGE:9022 EMAGE:9022 EMAGE:9022
"Pseudo-wholemount" of euxassay_012891. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012891_01 euxassay_012891_02 euxassay_012891_03 euxassay_012891_04
EMAGE:9022 EMAGE:9022 EMAGE:9022 EMAGE:9022 EMAGE:9022
euxassay_012891_05 euxassay_012891_06 euxassay_012891_07 euxassay_012891_08 euxassay_012891_09
EMAGE:9022 EMAGE:9022 EMAGE:9022 EMAGE:9022 EMAGE:9022
euxassay_012891_10 euxassay_012891_11 euxassay_012891_12 euxassay_012891_13 euxassay_012891_14
EMAGE:9022 EMAGE:9022 EMAGE:9022 EMAGE:9022 EMAGE:9022
euxassay_012891_15 euxassay_012891_16 euxassay_012891_17 euxassay_012891_18 euxassay_012891_19
EMAGE:9022 EMAGE:9022 EMAGE:9022 EMAGE:9022
euxassay_012891_20 euxassay_012891_21 euxassay_012891_22 euxassay_012891_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9022Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9022_wholemount_strong.wlz
9022_wholemount_moderate.wlz
9022_wholemount_weak.wlz
9022_wholemount_possible.wlz
9022_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9022_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
pancreas
moderate moderate
regionalmoderate expression: see section 09 10 11
cerebral cortex mantle layer
weak weak
regionalweak expression: see section 03 04 05 06 21 22
cerebral cortex marginal layer
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38670
Entity Detected:Abcc8, ATP-binding cassette, sub-family C (CFTR/MRP), member 8 ( MGI:1352629)
Sequence:sense strand is shown

>T38670
AGCTCTTTGAGCATTGGAAGACCCTCATGAACAGGCAAGACCAAGAGCTGGAGAAGGAGACAGTCATGGA
GAGGAAAGCCCCAGAACCGTCTCAGGGCCTGCCCCGTGCCATGTCCTCAAGAGATGGCCTTCTGCTGGAT
GAGGACGAGGAGGAAGAGGAGGCGGCCGAGAGCGAGGAAGATGACAACTTATCTTCGGTGCTGCATCAGC
GAGCCAAGATCCCATGGCGGGCCTGCACTAAGTATTTGTCCTCTGCCGGCGTCCTGCTCTTGTCCCTGCT
TGTCTTCTCCCAGCTACTCAAGCACATGGTCTTGGTGGCCATTGATTACTGGCTGGCCAAGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 154772. Forward Primer - name:154772_F_cDNA_TC1560342, sequence:AGCTCTTTGAGCATTGGAAGAC; Reverse Primer - name:154772_N_SP6_cDNA_TC1560342, sequence:ACTTGGCCAGCCAGTAATCAA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9026 same embryo
 EMAGE:9024 same embryo
 EMAGE:9025 same embryo
 EMAGE:9023 same embryo
 EMAGE:9021 same embryo
 EurExpress:euxassay_012891 same experiment
 MGI:4822865 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS