Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:9945

Wdr11 WD repeat domain 11 ( MGI:1920230)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:9945 EMAGE:9945 EMAGE:9945 EMAGE:9945 EMAGE:9945
"Pseudo-wholemount" of euxassay_000103. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000103_01 euxassay_000103_02 euxassay_000103_03 euxassay_000103_04
EMAGE:9945 EMAGE:9945 EMAGE:9945 EMAGE:9945 EMAGE:9945
euxassay_000103_05 euxassay_000103_06 euxassay_000103_07 euxassay_000103_08 euxassay_000103_09
EMAGE:9945 EMAGE:9945 EMAGE:9945 EMAGE:9945 EMAGE:9945
euxassay_000103_10 euxassay_000103_11 euxassay_000103_12 euxassay_000103_13 euxassay_000103_14
EMAGE:9945 EMAGE:9945 EMAGE:9945 EMAGE:9945 EMAGE:9945
euxassay_000103_15 euxassay_000103_16 euxassay_000103_17 euxassay_000103_18 euxassay_000103_19
EMAGE:9945 EMAGE:9945 EMAGE:9945 EMAGE:9945 EMAGE:9945
euxassay_000103_20 euxassay_000103_21 euxassay_000103_22 euxassay_000103_23 euxassay_000103_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:9945Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
9945_wholemount_strong.wlz
9945_wholemount_moderate.wlz
9945_wholemount_weak.wlz
9945_wholemount_possible.wlz
9945_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:9945_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
organ system
weak weak
homogeneousweak expression: see section 11
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 19 20
vibrissa
moderate moderate
regionalmoderate expression: see section 22 23 weak expression: see section 24
cranial ganglion
moderate moderate
regionalmoderate expression: see section 19 20
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 19 23 weak expression: see section 04 06 22 24
vagus x ganglion
weak weak
regionalweak expression: see section 06
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 06
dorsal root ganglion
moderate moderate
homogeneousmoderate expression: see section 17 18 19 weak expression: see section 09 11
otic capsule
weak weak
regionalweak expression: see section 24
metanephros
weak weak
homogeneousweak expression: see section 10 22
metanephros
moderate moderate
regionalmoderate expression: see section 23
renal cortex
weak weak
homogeneousweak expression: see section 10 11
frontal bone primordium
weak weak
regionalweak expression: see section 01 04 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T252
Entity Detected:Wdr11, WD repeat domain 11 ( MGI:1920230)
Sequence:sense strand is shown

>T252
GGGGAGGGCCAGGGTGCCGCCGCGATGTTACCCTACACCGTAAACTTCAAGGTGTCAGCGCGCACCCTCA
CCGGGGCTCTCAACGCGCACAACAAGGCGGCGGTGGACTGGGGCTGGCAAGGTTTAATTGCATATGGATG
CCATTCACTGGTGGTAGTGATCGATTCCAATACTGCCCAAACTCTACAAGTTCTAGAAAAACATAAAGCT
GATATTGTTAAGGTCAGGTGGGCCAGGGAGAACTATCACCACAACATCGGCTCTCCATACTGCCTGCGCT
TGGCTTCTGCGGATGTCACTGGAAAGATCATTGTCTGGGATGTAGCAGCCGGAGTAGCCCAGTGTGAGAT
CCAAGAGCACGTGAAGCCCATCCAAGATGTGCAGTGGCTGTGGAATCAGGACGCTTCCCGAGACTTGCTG
CTCGCTATCCACCCGCCTAATTACATCGTGCTGTGGAATGCAGACACGGGCACCAAGCTGTGGAAGAAGA
GCTACGCAGATAACATCCTTTCTTT
Notes:The probe template was PCR amplified from IMAGE:2651629 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2651629 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:9946 same embryo
 EMAGE:9944 same embryo
 EurExpress:euxassay_000103 same experiment
 MGI:4829192 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS