Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10032

Arrdc1 arrestin domain containing 1 ( MGI:2446136)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10032 EMAGE:10032 EMAGE:10032 EMAGE:10032 EMAGE:10032
"Pseudo-wholemount" of euxassay_008195. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008195_01 euxassay_008195_02 euxassay_008195_03 euxassay_008195_04
EMAGE:10032 EMAGE:10032 EMAGE:10032 EMAGE:10032 EMAGE:10032
euxassay_008195_05 euxassay_008195_06 euxassay_008195_07 euxassay_008195_08 euxassay_008195_09
EMAGE:10032 EMAGE:10032 EMAGE:10032 EMAGE:10032 EMAGE:10032
euxassay_008195_10 euxassay_008195_11 euxassay_008195_12 euxassay_008195_13 euxassay_008195_14
EMAGE:10032 EMAGE:10032 EMAGE:10032 EMAGE:10032 EMAGE:10032
euxassay_008195_15 euxassay_008195_16 euxassay_008195_17 euxassay_008195_18 euxassay_008195_19
EMAGE:10032 EMAGE:10032 EMAGE:10032 EMAGE:10032 EMAGE:10032
euxassay_008195_20 euxassay_008195_21 euxassay_008195_22 euxassay_008195_23 euxassay_008195_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10032Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10032_wholemount_strong.wlz
10032_wholemount_moderate.wlz
10032_wholemount_weak.wlz
10032_wholemount_possible.wlz
10032_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10032_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
pituitary gland
moderate moderate
spottedmoderate expression: see section 12 13 14 15 16
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 11 12 13 15 18 19 20 21
nasal cavity respiratory epithelium
weak weak
regionalweak expression: see section 15 16 19 20
heart ventricle
moderate moderate
spottedmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
hindgut
weak weak
regionalweak expression: see section 13 15 16 17 18 19
rectum
moderate moderate
regionalmoderate expression: see section 13
midgut
weak weak
regionalweak expression: see section 10 11 12 13 14 15 16 17 18 19
bladder
moderate moderate
regionalExpression in the fundus region.
urethra of male
moderate moderate
regionalmoderate expression: see section 13 14 15
lung
moderate moderate
spottedmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T361
Entity Detected:Arrdc1, arrestin domain containing 1 ( MGI:2446136)
Sequence:sense strand is shown

>T361
CTCACTTCTCAGACCCAGTTTCTCTCTCCACCAAGAGCCACTCTCAGCAGCAGCCACTGTCGGCTCCCTT
GGGTTCTGTGTCTGTCACCACCACTGAGCCCTGGGTTCAGGTTGGAAGCCCTGCTAGACATTCTCTGCAC
CCTCCCTTGTGCATCTCTATAGGTGCCACTGTCCCCTACTTTGCAGAAGGCTCTGCGGGCCCAGTACCCA
CCACCAGCGCCTTGATCCTCCCTCCAGAGTACAGTTCATGGGGCTACCCCTATGAGGCCCCGCCGTCCTA
TGAGCAGAGCTGTGGTGCTGCTGGTACAGACCTTGGCCTGATCCCAGGAAGCTGACCCTGGTGTGCTAAC
CCATACCACCTTGTTCGGTGGTTCTGGCCTTTGCCTTGGCATGGAATGTCCAGGGCCTCGTGCCTTTGCT
CTCTACCTGGCTCAGCTACTCAGGACCTGCAGCTGTCGGGATGACCCCTTGTGGACCAGCCACTCCTGGC
TCCTCTGGAATTACTC
Notes:The probe template was PCR amplified from IMAGE:3155651 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3155651 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10034 same embryo
 EMAGE:10035 same embryo
 EMAGE:10033 same embryo
 EurExpress:euxassay_008195 same experiment
 MGI:4823259 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS