EMAGE mouse gene expression spatial database

EMAGE:10035

Ndufa2 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2 ( MGI:1343103)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_008204. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_008204_01	euxassay_008204_02	euxassay_008204_03	euxassay_008204_04

euxassay_008204_05	euxassay_008204_06	euxassay_008204_07	euxassay_008204_08	euxassay_008204_09

euxassay_008204_10	euxassay_008204_11	euxassay_008204_12	euxassay_008204_13	euxassay_008204_14

euxassay_008204_15	euxassay_008204_16	euxassay_008204_17	euxassay_008204_18	euxassay_008204_19

euxassay_008204_20	euxassay_008204_21	euxassay_008204_22	euxassay_008204_23	euxassay_008204_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T363
Entity Detected:	Ndufa2, NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2 ( MGI:1343103)
Sequence:	sense strand is shown >T363 CAAAGATGGCGGCTGCCGCTGCTAGCCGAGCGGTCGGCGCAAAGCTGGGGTTGCGTGAGATTCGCGTTCA CTTATGCCAGCGTTCCCCAGGCAGCCAGGGTGTGAGGGATTTCATCGTGCAACGGTACGTGGAGCTGAAG AAGGCGCACCCCAACCTGCCCATTCTGATCCGCGAATGCTCGGAGGTGCAGCCCAAGCTTTGGGCCCGCT ATGCTTTTGGCCAAGAGAAGACGGTGTCTCTGAACAATCTGAGTGCTGATGAGGTAACCAGAGCCATGCA GAATGTGCTAAGCGGCAAAGCCTGAAGGTCTCCACTGAGGACTGTGAGCGAGAGCAGCTGAACCTGCTGG ACTGAAGACAGTGTGGGGAAATGTGTGCTTTGGGTCCTTATAAAGCTTACGCTGTACAGTGAAAAAAAAA AAAAAA
Notes:	The probe template was PCR amplified from IMAGE:3155763 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:3155763 which was retrieved directly from NCBI.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:10034 same embryo
	EMAGE:10032 same embryo
	EMAGE:10033 same embryo
	EurExpress:euxassay_008204 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source