Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10372

Etv5 ets variant gene 5 ( MGI:1096867)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10372 EMAGE:10372 EMAGE:10372 EMAGE:10372 EMAGE:10372
"Pseudo-wholemount" of euxassay_000518. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000518_01 euxassay_000518_02 euxassay_000518_03 euxassay_000518_04
EMAGE:10372 EMAGE:10372 EMAGE:10372 EMAGE:10372 EMAGE:10372
euxassay_000518_05 euxassay_000518_06 euxassay_000518_07 euxassay_000518_08 euxassay_000518_09
EMAGE:10372 EMAGE:10372 EMAGE:10372 EMAGE:10372 EMAGE:10372
euxassay_000518_10 euxassay_000518_11 euxassay_000518_12 euxassay_000518_13 euxassay_000518_14
EMAGE:10372 EMAGE:10372 EMAGE:10372 EMAGE:10372 EMAGE:10372
euxassay_000518_15 euxassay_000518_16 euxassay_000518_17 euxassay_000518_18 euxassay_000518_19
EMAGE:10372 EMAGE:10372 EMAGE:10372 EMAGE:10372 EMAGE:10372
euxassay_000518_20 euxassay_000518_21 euxassay_000518_22 euxassay_000518_23 euxassay_000518_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10372Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10372_wholemount_strong.wlz
10372_wholemount_moderate.wlz
10372_wholemount_weak.wlz
10372_wholemount_possible.wlz
10372_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10372_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 10 11 16 17 18 19
olfactory cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 16 17
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 15 16 17 19 20 21 22 23 weak expression: see section 18
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 11 13 14 15
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 13 14 15 16 17 18 19 20 21
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 13 14 15 16 17 18
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
otic capsule
moderate moderate
regionalmoderate expression: see section 02 03 21 22 23 24
viscerocranium
weak weak
regionalExpression in the turbinate bone.
lower jaw incisor
weak weak
regionalweak expression: see section 11 12 15 16
upper jaw incisor
weak weak
regionalweak expression: see section 11 12 16 17
kidney calyx
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 17 18 19 20 21
testis
moderate moderate
regionalmoderate expression: see section 05 06 07 08 weak expression: see section 20 21 22
lung
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
cranium
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 16 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3590
Entity Detected:Etv5, ets variant gene 5 ( MGI:1096867)
Sequence:sense strand is shown

>T3590
GGCTACTTTTTCGTTTTTTTAAATTTTTTATTCTGATTGCTGTATTATATTGGGGATGTTCTAAACAACC
AAACTAAAGCTGTGTACAGATTGGGTTTGGAGCGGTGGGGACGTCAGCAGGAAACGCCAGTGCTTTGCTG
CCTGATTGACAGGAATTTGCTGTCCTTGACACTCCACACATTGTGTTCCTCACGTGTGGGACAGGACACA
GAGCTGACTGAGCGTGGGACACTCCACAGCCTTCTCATGACTTGTGAAGGAGGTTCACAGGAACGAGGGG
TATGTTTTAGAGCTATGAGAACCTAGTCAGCCCACAGAGGCGTCAAACCTGAAGCTTGGGCCTTAATTAG
CATTGTACTCTGATGAAAGGACTCTTTCATAAGCATATTTATAGCTTTCTAATCTATACACAGTCTATCC
ATAGATGCATATTTTACCCCAACTGGCTAGAGATTTATTTGTTGTAAATGCTGTATAGATTTTGGGTTTT
TTTTTTTTGTTCTTCCTCTCTTCACTTATACTGGTGTGGGGTTTGT
Notes:The probe template was PCR amplified from IMAGE:3167503 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3167503 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10367 same embryo
 EMAGE:10369 same embryo
 EMAGE:10368 same embryo
 EMAGE:10371 same embryo
 EMAGE:10370 same embryo
 EurExpress:euxassay_000518 same experiment
 MGI:4824635 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS