Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10461

Atp6v1e1 ATPase, H+ transporting, lysosomal V1 subunit E1 ( MGI:894326)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10461 EMAGE:10461 EMAGE:10461 EMAGE:10461 EMAGE:10461
"Pseudo-wholemount" of euxassay_000678. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000678_01 euxassay_000678_02 euxassay_000678_03 euxassay_000678_04
EMAGE:10461 EMAGE:10461 EMAGE:10461 EMAGE:10461 EMAGE:10461
euxassay_000678_05 euxassay_000678_06 euxassay_000678_07 euxassay_000678_08 euxassay_000678_09
EMAGE:10461 EMAGE:10461 EMAGE:10461 EMAGE:10461 EMAGE:10461
euxassay_000678_10 euxassay_000678_11 euxassay_000678_12 euxassay_000678_13 euxassay_000678_14
EMAGE:10461 EMAGE:10461 EMAGE:10461 EMAGE:10461 EMAGE:10461
euxassay_000678_15 euxassay_000678_16 euxassay_000678_17 euxassay_000678_18 euxassay_000678_19
EMAGE:10461 EMAGE:10461 EMAGE:10461 EMAGE:10461
euxassay_000678_20 euxassay_000678_21 euxassay_000678_22 euxassay_000678_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10461Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10461_wholemount_strong.wlz
10461_wholemount_moderate.wlz
10461_wholemount_weak.wlz
10461_wholemount_possible.wlz
10461_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10461_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal gland
strong strong
homogeneousstrong expression: see section 08 09 10 11 17 18 19
medulla oblongata basal plate
weak weak
homogeneousweak expression: see section 07 08 09 17
facial vii ganglion
moderate moderate
homogeneousmoderate expression: see section 05 06 19 weak expression: see section 07
inferior glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 18 19 weak expression: see section 06 07
superior glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 18 19 weak expression: see section 07
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 03 04 05 06 07 08 09 17 18 19 weak expression: see section 20 21
vagus x ganglion
moderate moderate
homogeneousmoderate expression: see section 08 09 17
vestibulocochlear viii ganglion cochlear component
moderate moderate
homogeneousmoderate expression: see section 18 weak expression: see section 06 07 19
vestibulocochlear viii ganglion vestibular component
moderate moderate
homogeneousmoderate expression: see section 05 08 17 18 weak expression: see section 06 07 19 20
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 12 16 17 18 weak expression: see section 08 09 10 11
kidney calyx
moderate moderate
regionalmoderate expression: see section 20 weak expression: see section 08 09 19
testis
moderate moderate
homogeneousmoderate expression: see section 07 weak expression: see section 06 08 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1439
Entity Detected:Atp6v1e1, ATPase, H+ transporting, lysosomal V1 subunit E1 ( MGI:894326)
Sequence:sense strand is shown

>T1439
TCCTCGAGCCTGTTGGCCTACTGGAAAGTAAAGGAAGCTGGACCTCCCAGGGTTTTCGTCTCAGGTTTGC
TCCGCCGCCACTTTGAACCCAGATTCGAAGCTGTCCCCTGGCCGGACCTTGCCTTCGCCATGGCGCTCAG
CGATGCAGATGTACAGAAGCAGATTAAGCACATGATGGCTTTCATTGAACAAGAAGCCAATGAGAAAGCA
GAAGAAATAGATGCAAAGGCAGAAGAAGAGTTCAACATTGAGAAAGGTCGCCTTGTGCAAACGCAAAGAC
TGAAGATTATGGAATACTACGAGAAGAAAGAAAAGCAGATTGAGCAGCAGAAGAAAATTCAGATGTCCAA
CTTGATGAATCAAGCAAGGCTCAAAGTCCTCAGAACAAGGGATGACCTCATCACTGATCTGCTAAATGAG
GCAAAGCAAAGACTCAGTAAGGTGGTAAAAGATACGACCCGTTACCAAGTGCTGCTGGATGGGCTGGTCC
TTCAGGGCTTGTACCAGCTGCTGGAGCCTAGAATGATCGTGCGTTGCAGAAAACAAGATTTCCCTTTGGT
GAAGGCCGCAGTACAAAAAGCAAT
Notes:The probe template was PCR amplified from IMAGE:2503323 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2503323 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10462 same embryo
 EMAGE:10463 same embryo
 EMAGE:10465 same embryo
 EMAGE:10460 same embryo
 EMAGE:10464 same embryo
 EMAGE:10459 same embryo
 EurExpress:euxassay_000678 same experiment
 MGI:4823334 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS