Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10529

Prrc1 proline-rich coiled-coil 1 ( MGI:1916106)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10529 EMAGE:10529 EMAGE:10529 EMAGE:10529 EMAGE:10529
"Pseudo-wholemount" of euxassay_000739. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000739_01 euxassay_000739_02 euxassay_000739_03 euxassay_000739_04
EMAGE:10529 EMAGE:10529 EMAGE:10529 EMAGE:10529 EMAGE:10529
euxassay_000739_05 euxassay_000739_06 euxassay_000739_07 euxassay_000739_08 euxassay_000739_09
EMAGE:10529 EMAGE:10529 EMAGE:10529 EMAGE:10529 EMAGE:10529
euxassay_000739_10 euxassay_000739_11 euxassay_000739_12 euxassay_000739_13 euxassay_000739_14
EMAGE:10529 EMAGE:10529 EMAGE:10529 EMAGE:10529 EMAGE:10529
euxassay_000739_15 euxassay_000739_16 euxassay_000739_17 euxassay_000739_18 euxassay_000739_19
EMAGE:10529 EMAGE:10529 EMAGE:10529 EMAGE:10529 EMAGE:10529
euxassay_000739_20 euxassay_000739_21 euxassay_000739_22 euxassay_000739_23 euxassay_000739_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10529Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10529_wholemount_strong.wlz
10529_wholemount_moderate.wlz
10529_wholemount_weak.wlz
10529_wholemount_possible.wlz
10529_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10529_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 07 08 09 10 11 14 15 16 17 18 19 20
meckel's cartilage
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 16 17 18 19 20
chondrocranium
moderate moderate
regionalmoderate expression: see section 22 23 24 weak expression: see section 01 02 03 04 05 06 07 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T956
Entity Detected:Prrc1, proline-rich coiled-coil 1 ( MGI:1916106)
Sequence:sense strand is shown

>T956
TCTCGAGNCTGTTGGCCTACTGGTTCTTGGCGCGGGGCACACGCTCCTCTGGTCTTCCTCGTCCACCGTA
AGCCGGATCCCCGCGAGGGACCCCCGACCCGGCCCCCGACCCCGATCCGCGTGTGCAGCTTCTGCGCAGG
CGCTCGCTCCGACCCAGTGTGCCGTAACTGAGGGAAAATGATGGAAGAAAGTGGAATCGAGACCACGCCG
CCTGGAACCCCTCCCCTGCATCCTGCAGGCTTGGCTGCCGTGCCCTCCACTGAAGCTCACTCAGCTGCAA
CCAGTTCCTTCTCGTCTCCCAACGTGTCGGGGATGGAGTCTCTGCCCCCACACGTGTATTCCACGCCTCA
GCCCTCCCTGCCCCCTGTGCAGCCGTCCGCGCCACCTCCCTTTGTGTCGATGTCTCCGGCTCCTTCCGTT
CCCCTGAGTGGCACTTCTGTGCCGCCCTCCGTGTCTCCATCGCCTGCCACTGCCTTCAGCGGCCCTCCGA
TGTCCCACTTCCCGCCTGCGACCTCTGCCTCGGGTGCTCTCCTGTCTGCACCGCCT
Notes:The probe template was PCR amplified from IMAGE:1970439 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1970439 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10533 same embryo
 EMAGE:10532 same embryo
 EMAGE:10531 same embryo
 EMAGE:10530 same embryo
 EMAGE:10534 same embryo
 EurExpress:euxassay_000739 same experiment
 MGI:4827451 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS