Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10582

Ankrd43 ankyrin repeat domain 43 ( MGI:2687280)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10582 EMAGE:10582 EMAGE:10582 EMAGE:10582 EMAGE:10582
"Pseudo-wholemount" of euxassay_000810. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000810_01 euxassay_000810_02 euxassay_000810_03 euxassay_000810_04
EMAGE:10582 EMAGE:10582 EMAGE:10582 EMAGE:10582 EMAGE:10582
euxassay_000810_05 euxassay_000810_06 euxassay_000810_07 euxassay_000810_08 euxassay_000810_09
EMAGE:10582 EMAGE:10582 EMAGE:10582 EMAGE:10582 EMAGE:10582
euxassay_000810_10 euxassay_000810_11 euxassay_000810_12 euxassay_000810_13 euxassay_000810_14
EMAGE:10582 EMAGE:10582 EMAGE:10582 EMAGE:10582 EMAGE:10582
euxassay_000810_15 euxassay_000810_16 euxassay_000810_17 euxassay_000810_18 euxassay_000810_19
EMAGE:10582 EMAGE:10582 EMAGE:10582 EMAGE:10582 EMAGE:10582
euxassay_000810_20 euxassay_000810_21 euxassay_000810_22 euxassay_000810_23 euxassay_000810_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10582Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10582_wholemount_strong.wlz
10582_wholemount_moderate.wlz
10582_wholemount_weak.wlz
10582_wholemount_possible.wlz
10582_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10582_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
corpus striatum
strong strong
regionalstrong expression: see section 07 08 20 21 moderate expression: see section 06 22 weak expression: see section 05 23
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 13 16 17 moderate expression: see section 12 18 weak expression: see section 09 10 11 19 20
not examined not examined
regionalExpression in the turbinate bone.
liver lobe
strong strong
spottedstrong expression: see section 13 14 17 18 19 20 22 23 24 moderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 15 16 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3942
Entity Detected:Ankrd43, ankyrin repeat domain 43 ( MGI:2687280)
Sequence:sense strand is shown

>T3942
CGGTCCGCGCCTGCTGAGTCCGGACACGGAGGAGATGCCCGTCGCGCCGCTACCGTCACCCGCGGTGCCC
CTGGAGCCCACGGAGCACGAGTGGCTGGTGCGCACGGCCAGCGGTCGTTGGAGTCACCAGCTGCACGGGT
TGCTCTTGCGGGACCGCGGCCTGGCTGCCAAGCGCGACTTCATGTCCGGCTTCACCGCGCTACACTGGGC
GGCCAAGAACGGCGACCGGGAGATGGCTTTACAGCTGGTGGAGGTGGCGCGGCGTGGAGGCGCGCCCGTG
GACGTGAACGCGCGCTCTCACGGTGGCTACACGCCGCTGCACCTGGCGGCTCTGCACGGCCACGAGGATG
CTGCTGTGCTGCTAGTGGTGCGCTTGGGTGCCCAAGTGCACGTCCGCGACTACAGCGGCCGGCGTGCCTA
CCAGTACCTAC
Notes:The probe template was PCR amplified from IMAGE:3813362 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3813362 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10584 same embryo
 EMAGE:10586 same embryo
 EMAGE:10581 same embryo
 EMAGE:10583 same embryo
 EMAGE:10585 same embryo
 EurExpress:euxassay_000810 same experiment
 MGI:4823136 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS