Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10590

Tmco3 transmembrane and coiled-coil domains 3 ( MGI:2444946)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10590 EMAGE:10590 EMAGE:10590 EMAGE:10590 EMAGE:10590
"Pseudo-wholemount" of euxassay_000930. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000930_01 euxassay_000930_02 euxassay_000930_03 euxassay_000930_04
EMAGE:10590 EMAGE:10590 EMAGE:10590 EMAGE:10590 EMAGE:10590
euxassay_000930_05 euxassay_000930_06 euxassay_000930_07 euxassay_000930_08 euxassay_000930_09
EMAGE:10590 EMAGE:10590 EMAGE:10590 EMAGE:10590 EMAGE:10590
euxassay_000930_10 euxassay_000930_11 euxassay_000930_12 euxassay_000930_13 euxassay_000930_14
EMAGE:10590 EMAGE:10590 EMAGE:10590 EMAGE:10590 EMAGE:10590
euxassay_000930_15 euxassay_000930_16 euxassay_000930_17 euxassay_000930_18 euxassay_000930_19
EMAGE:10590 EMAGE:10590 EMAGE:10590 EMAGE:10590 EMAGE:10590
euxassay_000930_20 euxassay_000930_21 euxassay_000930_22 euxassay_000930_23 euxassay_000930_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10590Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10590_wholemount_strong.wlz
10590_wholemount_moderate.wlz
10590_wholemount_weak.wlz
10590_wholemount_possible.wlz
10590_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10590_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 14
medulla oblongata basal plate
weak weak
homogeneousweak expression: see section 08 09 10 11 17 18
pons ventricular layer
strong strong
homogeneousstrong expression: see section 13
midbrain ventricular layer
strong strong
regionalstrong expression: see section 13
ventral grey horn
weak weak
regionalweak expression: see section 12 13 15 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2186
Entity Detected:Tmco3, transmembrane and coiled-coil domains 3 ( MGI:2444946)
Sequence:sense strand is shown

>T2186
TGGCCTCGAGCCAGATTCGGATCCTTGGTCTTGTCTCTCATCCTGCCGAGGAGCAGCCAGTACATCAAGT
GGATCGTATCCGCTGGGCTGGCACAGGTCAGCGAGTTCTCCTTTGTCCTGGGGAGTCGAGCACGGAGAGC
AGGCATCCTCTCCAGAGAGGTGTACCTCCTTATCCTAAGTGTGACCACACTCAGCCTCTTACTCGCCCCA
GTGCTGTGGAAAGCAGCCATTACCAAGTGTGTGCCGAGACCAGAGAGGCGCTCAAGTCTCTGACAACACC
CGAGGACGACAGGCTGTGGGGCAAGGATCCTTCGGGGGTTCCAGTCCCGAGACGGTCTGCTGCTGCGCCT
CTCTGCTGGCTTCCCAGCAGAGACAGAGTAACACGGGCCAAGAGGCAGCGCCCTCATGCTTGCTTGCTAT
TTCAAAGACTCTCCTGTCATGTTTAAGAATTTTCCAGAGTAATTTATTTGCAGTCAGTTGATTATGTACA
GAGTTTTAACACTGCATTTTACAATCACCTGAACTATTTTGCCTGGATGTGCCTTTTTTAATGAAAATTA
TTAACTTCCA
Notes:The probe template was PCR amplified from IMAGE:902011 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:902011 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10592 same embryo
 EMAGE:10591 same embryo
 EMAGE:10588 same embryo
 EMAGE:10587 same embryo
 EMAGE:10589 same embryo
 EurExpress:euxassay_000930 same experiment
 MGI:4828758 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS