Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10745

Ifngr1 interferon gamma receptor 1 ( MGI:107655)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10745 EMAGE:10745 EMAGE:10745 EMAGE:10745 EMAGE:10745
"Pseudo-wholemount" of euxassay_001043. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001043_01 euxassay_001043_02 euxassay_001043_03 euxassay_001043_04
EMAGE:10745 EMAGE:10745 EMAGE:10745 EMAGE:10745 EMAGE:10745
euxassay_001043_05 euxassay_001043_06 euxassay_001043_07 euxassay_001043_08 euxassay_001043_09
EMAGE:10745 EMAGE:10745 EMAGE:10745 EMAGE:10745 EMAGE:10745
euxassay_001043_10 euxassay_001043_11 euxassay_001043_12 euxassay_001043_13 euxassay_001043_14
EMAGE:10745 EMAGE:10745 EMAGE:10745 EMAGE:10745 EMAGE:10745
euxassay_001043_15 euxassay_001043_16 euxassay_001043_17 euxassay_001043_18 euxassay_001043_19
EMAGE:10745 EMAGE:10745 EMAGE:10745 EMAGE:10745 EMAGE:10745
euxassay_001043_20 euxassay_001043_21 euxassay_001043_22 euxassay_001043_23 euxassay_001043_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10745Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10745_wholemount_strong.wlz
10745_wholemount_moderate.wlz
10745_wholemount_weak.wlz
10745_wholemount_possible.wlz
10745_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10745_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 12 13 14 15 16
hindgut
weak weak
regionalweak expression: see section 14
midgut
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 16 17 18 19 20 21 22 23 24
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 not examined expression: see section 19
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 18 19 20 21 22
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 18 19
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 18 19 20 21 22 23
liver lobe
weak weak
spottedweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
chondrocranium
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T197
Entity Detected:Ifngr1, interferon gamma receptor 1 ( MGI:107655)
Sequence:sense strand is shown

>T197
CGACTAGTCTGCGGCGGACGTGACGCCAAGGCCAGGCCACGGGCAGCGCGGGTCCCCTGTCAGAGGTGTC
CCTCGCGCAGGAATGGGCCCGCAGGCGGCAGCTGGCAGGATGATTCTGCTGGTGGTCCTGATGCTGTCTG
CGAAGGTCGGGAGTGGAGCTTTGACGAGCACTGAGGATCCTGAGCCTCCCTCGGTGCCTGTACCGACGAA
TGTTCTAATTAAGTCTTATAACTTGAACCCTGTCGTATGCTGGGAATACCAGAACATGTCACAGACTCCT
ATTTTTACTGTACAGGTAAAGGTGTATTCGGGTTCCTGGACTGATTCCTGCACCAACATTTCTGATCATT
GTTGTAATATCTATGAACAAATTATGTATCCTGATGTATCTGCCTGGGCCAGAGTTAAAGCTAAGGTTGG
ACAAAAAGAATCTGACTATGCACGGTCAAAAGAGTTCCTTATGTGCC
Notes:The probe template was PCR amplified from IMAGE:2648386 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2648386 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10748 same embryo
 EMAGE:10747 same embryo
 EMAGE:10750 same embryo
 EMAGE:10749 same embryo
 EMAGE:10746 same embryo
 EurExpress:euxassay_001043 same experiment
 MGI:4825525 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS