Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10926

BC002163 cDNA sequence BC002163 ( MGI:3612445)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10926 EMAGE:10926 EMAGE:10926 EMAGE:10926 EMAGE:10926
"Pseudo-wholemount" of euxassay_003373. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_003373_01 euxassay_003373_02 euxassay_003373_03 euxassay_003373_04
EMAGE:10926 EMAGE:10926 EMAGE:10926 EMAGE:10926 EMAGE:10926
euxassay_003373_05 euxassay_003373_06 euxassay_003373_07 euxassay_003373_08 euxassay_003373_09
EMAGE:10926 EMAGE:10926 EMAGE:10926 EMAGE:10926 EMAGE:10926
euxassay_003373_10 euxassay_003373_11 euxassay_003373_12 euxassay_003373_13 euxassay_003373_14
EMAGE:10926 EMAGE:10926 EMAGE:10926 EMAGE:10926 EMAGE:10926
euxassay_003373_15 euxassay_003373_16 euxassay_003373_17 euxassay_003373_18 euxassay_003373_19
EMAGE:10926 EMAGE:10926 EMAGE:10926 EMAGE:10926
euxassay_003373_20 euxassay_003373_21 euxassay_003373_22 euxassay_003373_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10926Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10926_wholemount_strong.wlz
10926_wholemount_moderate.wlz
10926_wholemount_weak.wlz
10926_wholemount_possible.wlz
10926_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10926_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vibrissa
weak weak
regionalweak expression: see section 07 08 09 22 23
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 10 11 17 18 weak expression: see section 12 15 16
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 15 16 weak expression: see section 08 09
pons mantle layer
moderate moderate
regionalmoderate expression: see section 07 16 17
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 20 weak expression: see section 05 06 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 07 08 09 17 18 19 20 weak expression: see section 05 06 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 17
ventral grey horn
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 weak expression: see section 14 15 not examined expression: see section 07
dorsal root ganglion
weak weak
regionalweak expression: see section 09 10 11 12 16 17
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 17 18
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T5987
Entity Detected:BC002163, cDNA sequence BC002163 ( MGI:3612445)
Sequence:sense strand is shown

>T5987
CCCACGCGTCCGAGCCGGCGGTCGGGAATTGCACCAGGGACCTGACAAGGGCACTGCAGAGCCATGCCTT
TCCTTGACATACAGAAAAAGCTGGGCATCAGCCTGGACCGGCACTTTATGTTCCTAAGTGCAGAACAGCC
CTACAAGAACGCCGCTCGGTGCCACGCGTTTGAAAAAGAGTGGATAGAGTGTGCACACGGGATCGGTGGG
ACCCGGGCGAAAAAGGAGTGCAAGATAGAGTTCGATGACTTCGAAGAGTGCTTGCTTCGGTACAAAACGA
TGAGGCGAATGCATGATATCAAGAAACAGCGGGAGAAGCTAATGAAAGAGGGCAAATACACCCCTCCACC
TCACCATTCGGGCAGGGAGGAGCCCAGGCCCTGAGCGGGGCAGCTGGAGGCCGCTGTCATGCTCTGTTTT
CCCCTGGAGAGAATATTTAAGGAAAGCTCCTTCATTAAGTATTAAGTATGTGGAAATAAAGAATTACTCA
GTCTTAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:3485964 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:3485964 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10927 same embryo
 EMAGE:10930 same embryo
 EMAGE:10929 same embryo
 EMAGE:10925 same embryo
 EMAGE:10928 same embryo
 EurExpress:euxassay_003373 same experiment
 MGI:4823402 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS