Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10930

Fabp3 fatty acid binding protein 3, muscle and heart ( MGI:95476)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10930 EMAGE:10930 EMAGE:10930 EMAGE:10930 EMAGE:10930
"Pseudo-wholemount" of euxassay_003367. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_003367_01 euxassay_003367_02 euxassay_003367_03 euxassay_003367_04
EMAGE:10930 EMAGE:10930 EMAGE:10930 EMAGE:10930 EMAGE:10930
euxassay_003367_05 euxassay_003367_06 euxassay_003367_07 euxassay_003367_08 euxassay_003367_09
EMAGE:10930 EMAGE:10930 EMAGE:10930 EMAGE:10930 EMAGE:10930
euxassay_003367_10 euxassay_003367_11 euxassay_003367_12 euxassay_003367_13 euxassay_003367_14
EMAGE:10930 EMAGE:10930 EMAGE:10930 EMAGE:10930 EMAGE:10930
euxassay_003367_15 euxassay_003367_16 euxassay_003367_17 euxassay_003367_18 euxassay_003367_19
EMAGE:10930 EMAGE:10930 EMAGE:10930 EMAGE:10930
euxassay_003367_20 euxassay_003367_21 euxassay_003367_22 euxassay_003367_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10930Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10930_wholemount_strong.wlz
10930_wholemount_moderate.wlz
10930_wholemount_weak.wlz
10930_wholemount_possible.wlz
10930_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10930_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
4th ventricle lateral recess
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 10 11 12 13 14 15 16 17 18 19 20 21 moderate expression: see section 09
ventral grey horn
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16
heart ventricle
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 08 09 10 19 20 21 22 23 weak expression: see section 04 05 06 07
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 13 17 18
lower jaw molar
moderate moderate
regionalmoderate expression: see section 08 09 10 18 19 20 21 22
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 13 17 18
upper jaw molar
moderate moderate
regionalmoderate expression: see section 08 09 10 18 19 20 21 22
cranium
moderate moderate
regionalmoderate expression: see section 01
orbito-sphenoid
strong strong
regionalstrong expression: see section 04 05 06 23 moderate expression: see section 01 02 03 07 22 weak expression: see section 08
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T5980
Entity Detected:Fabp3, fatty acid binding protein 3, muscle and heart ( MGI:95476)
Sequence:sense strand is shown

>T5980
GTGCCTGCTCGCCTCCTCACTCATCGCACCATGGCGGACGCCTTTGTCGGTACCTGGAAGCTAGTGGACA
GCAAGAATTTTGATGACTACATGAAGTCACTCGGTGTGGGCTTTGCCACCAGGCAGGTGGCTAGCATGAC
CAAGCCTACTACCATCATCGAGAAGAACGGGGATACTATCACCATAAAGACACAAAGTACCTTCAAGAAC
ACAGAGATCAACTTTCAGCTGGGAATAGAGTTCGACGAGGTGACAGCAGATGACCGGAAGGTCAAGTCAC
TGGTGACGCTGGACGGAGGCAAACTCATCCATGTGCAGAAGTGGAACGGGCAGGAGACAACACTAACTAG
GGAGCTAGTTGACGGGAAACTCATCCTGACTCTCACTCATGGCAGTGTGGTGAGCACTCGGACTTATGAG
AAGGAGGCGTGACCTGGCTGCTCCGTCACTGACCGCCCGCTCCTCTGCCAACTGGCCACCCCTCAGCTCA
GCACCATGCTGCCTCATGGTTTTCCCCTCTGACATTTTGTATAAACATTCTTGGGTTGGGATTTTTCTGG
AGATACGGGGCATCAGCCTGGACCCAGTTCCTACTATGTATGTGGTTTATTTTTTAAAACTGTATCCAAA
GGGTGCTCCAAGGTCAATAAAGCAGAACCAAGGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
A
Notes:The probe template was PCR amplified from IMAGE:3485639 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:3485639 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10927 same embryo
 EMAGE:10929 same embryo
 EMAGE:10926 same embryo
 EMAGE:10925 same embryo
 EMAGE:10928 same embryo
 EurExpress:euxassay_003367 same experiment
 MGI:4824675 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS