Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11004

Mapkapk3 mitogen-activated protein kinase-activated protein kinase 3 ( MGI:2143163)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11004 EMAGE:11004 EMAGE:11004 EMAGE:11004 EMAGE:11004
"Pseudo-wholemount" of euxassay_001044. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001044_01 euxassay_001044_02 euxassay_001044_03 euxassay_001044_04
EMAGE:11004 EMAGE:11004 EMAGE:11004 EMAGE:11004 EMAGE:11004
euxassay_001044_05 euxassay_001044_06 euxassay_001044_07 euxassay_001044_08 euxassay_001044_09
EMAGE:11004 EMAGE:11004 EMAGE:11004 EMAGE:11004 EMAGE:11004
euxassay_001044_10 euxassay_001044_11 euxassay_001044_12 euxassay_001044_13 euxassay_001044_14
EMAGE:11004 EMAGE:11004 EMAGE:11004 EMAGE:11004 EMAGE:11004
euxassay_001044_15 euxassay_001044_16 euxassay_001044_17 euxassay_001044_18 euxassay_001044_19
EMAGE:11004 EMAGE:11004 EMAGE:11004 EMAGE:11004 EMAGE:11004
euxassay_001044_20 euxassay_001044_21 euxassay_001044_22 euxassay_001044_23 euxassay_001044_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11004Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11004_wholemount_strong.wlz
11004_wholemount_moderate.wlz
11004_wholemount_weak.wlz
11004_wholemount_possible.wlz
11004_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11004_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal gland
weak weak
homogeneousweak expression: see section 08 09 10 16 17 18
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 11 12 13 14 15 16
foregut-midgut junction
weak weak
regionalweak expression: see section 13 14
vibrissa
moderate moderate
regionalmoderate expression: see section 06 07 22 23
ventral grey horn
moderate moderate
regionalmoderate expression: see section 12 13
external naris
moderate moderate
regionalmoderate expression: see section 12 14 17 18 weak expression: see section 13
esophagus
weak weak
regionalweak expression: see section 12 13 14
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 09 weak expression: see section 08 10
hindgut
weak weak
regionalweak expression: see section 12 13 14
midgut
weak weak
regionalweak expression: see section 12 13 14 15 16 17 18 19
lower jaw incisor
weak weak
regionalweak expression: see section 12 13 14 16 17 18
oral epithelium
weak weak
regionalweak expression: see section 07 08 10 11 12 13 14 15 16 17 18
upper jaw incisor
weak weak
regionalweak expression: see section 12 13 16 17 18
liver lobe
weak weak
spottedweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
bladder
weak weak
regionalweak expression: see section 13 14
kidney calyx
weak weak
spottedweak expression: see section 07 08 19 20
kidney pelvis
weak weak
spottedweak expression: see section 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1056
Entity Detected:Mapkapk3, mitogen-activated protein kinase-activated protein kinase 3 ( MGI:2143163)
Sequence:sense strand is shown

>T1056
TCGAGNCTGNNTGGCCTACTGGGAATATGCACCACGGCAAGCGCTGTCTCCTCATTGTCATGGAATGCAT
GGAGGGTGGTGAGCTGTTCAGCAGGATTCAGGAGCGTGGTGACCAGGCTTTCACTGAGAGAGAGGCTGCA
GAGATAATGCGGGACATTGGCACTGCCATCCAGTTCTTGCACAGCCGGAACATTGCCCACCGAGATGTCA
AGCCTGAAAACCTACTCTATACATCCAAGGAGAAGGGTGCTGTACTTAAACTCACCGATTTTGGCTTTGC
CAAGGAAACCACCCAAAATGCCCTCCAGACACCCTGCTACACTCCCTATTATGTGGCTCCTGAGGTCCTG
GGTCCAGAGAAGTATGACAAGTCCTGTGATATGTGGTCCCCTGGCGTCATCATGTACATCCTTTTGTGTG
GATTCCCACCCTTCTACTCCAACACCGGCCAGGCCATCTCTCCAGGAATGAAAAGAAGGATTCGCTTGGG
CCAGTATAGCTTCCCTAACCCTGAATGGTTAGATGTCTCTGAGGATGCCAAGCAGCTAATCCGCCTGCTC
CTGAAGACA
Notes:The probe template was PCR amplified from IMAGE:2088451 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2088451 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11005 same embryo
 EMAGE:11003 same embryo
 EMAGE:11002 same embryo
 EMAGE:11006 same embryo
 EurExpress:euxassay_001044 same experiment
 MGI:4826097 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS