Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11212

F8a factor 8-associated gene A ( MGI:95474)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11212 EMAGE:11212 EMAGE:11212 EMAGE:11212 EMAGE:11212
"Pseudo-wholemount" of euxassay_003337. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_003337_01 euxassay_003337_02 euxassay_003337_03 euxassay_003337_04
EMAGE:11212 EMAGE:11212 EMAGE:11212 EMAGE:11212 EMAGE:11212
euxassay_003337_05 euxassay_003337_06 euxassay_003337_07 euxassay_003337_08 euxassay_003337_09
EMAGE:11212 EMAGE:11212 EMAGE:11212 EMAGE:11212 EMAGE:11212
euxassay_003337_10 euxassay_003337_11 euxassay_003337_12 euxassay_003337_13 euxassay_003337_14
EMAGE:11212 EMAGE:11212 EMAGE:11212 EMAGE:11212 EMAGE:11212
euxassay_003337_15 euxassay_003337_16 euxassay_003337_17 euxassay_003337_18 euxassay_003337_19
EMAGE:11212 EMAGE:11212 EMAGE:11212 EMAGE:11212 EMAGE:11212
euxassay_003337_20 euxassay_003337_21 euxassay_003337_22 euxassay_003337_23 euxassay_003337_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11212Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11212_wholemount_strong.wlz
11212_wholemount_moderate.wlz
11212_wholemount_weak.wlz
11212_wholemount_possible.wlz
11212_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11212_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 11 12 13 weak expression: see section 14 15 16
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 moderate expression: see section 17 18 19
foregut-midgut junction
weak weak
regionalweak expression: see section 13 14 15 16 17
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 moderate expression: see section 24 weak expression: see section 02 03 04 05
stomach
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 weak expression: see section 11 12
midgut
moderate moderate
regionalmoderate expression: see section 09 10 weak expression: see section 11 12 13 14 15 16 17 18
liver lobe
strong strong
single cellstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
bladder
moderate moderate
regionalmoderate expression: see section 14 15 16 17
urethra of male
weak weak
regionalweak expression: see section 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T5344
Entity Detected:F8a, factor 8-associated gene A ( MGI:95474)
Sequence:sense strand is shown

>T5344
AAAGTCGGGCCGCCTCTGTGAGGGCCAGCGCTTCCCCGGGCCCATGGAAGAGCGCCTGCTGGCAGCGCGC
CACAGCCAGCTGGCACCAGGCAGCATAAGGCAGGCACTCCTGGGCGCGCAGCTCCCGGGCTAGCTGGGCG
AACTGCTCCCCGGCCTCGGCCACGTTCGGCTTCCTCAAGAAGCGCTTCTTGAGCTTGTTGGACAC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:GTGTCCAACAAGCTCAAGAAG; Reverse Primer - name:unspecified, sequence:GAGTACTTCTCCAGGGTCTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11214 same embryo
 EMAGE:11211 same embryo
 EMAGE:11213 same embryo
 EMAGE:11210 same embryo
 EurExpress:euxassay_003337 same experiment
 MGI:4824672 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS