EMAGE mouse gene expression spatial database

EMAGE:11455

Crygb crystallin, gamma B ( MGI:88522)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_006917. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_006917_01	euxassay_006917_02	euxassay_006917_03	euxassay_006917_04

euxassay_006917_05	euxassay_006917_06	euxassay_006917_07	euxassay_006917_08	euxassay_006917_09

euxassay_006917_10	euxassay_006917_11	euxassay_006917_12	euxassay_006917_13	euxassay_006917_14

euxassay_006917_15	euxassay_006917_16	euxassay_006917_17	euxassay_006917_18	euxassay_006917_19

euxassay_006917_20	euxassay_006917_21	euxassay_006917_22	euxassay_006917_23	euxassay_006917_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T9119
Entity Detected:	Crygb, crystallin, gamma B ( MGI:88522)
Sequence:	sense strand is shown >T9119 ACTCTCAGCGAGATGGGAAAGATCACCTTCTTCGAGGACCGCAGCTTCCAGGGCCGCTGCTATGAGTGCA GCAGCGACTGCCCCAACCTGCAGACCTACTTCAGCCGCTGCAATTCTGTCCGCGTGGACAGTGGCTGCTG GATGCTCTATGAGCGCCCCAACTACCAGGGCCACCAGTACTTCCTGAGACGTGGAGAGTACCCTGACTAC CAGCAGTGGATGGGTTTCAGCGACTCCATTCGTTCCTGCTGCCTCATCCCCCAACACTCTGGCACTTACA GAATGAGGATCTACGAAAAAGATGACTTCAGAGGACAAATGTCAGAGATCACAGACGATTGTCTCTCTCT TCAGGATCGCTTCCACTTCAGTGAAATCCACTCCCTCAATGTGATGGAGGGCTGCTGGGTTCTCTATGAG ATGCCTAGCTACAGAGGACGGCAGTACCTGCTAAGGCCGGGGGAGTACAGGAGATATCTTGACTGGGGGG CTGCAAATGCCAAAGTTGGCTCTTTTAGGCGAGTCATGGATTTTTACTGAGGCATTTTGAGACTCTACTT TCCTCCTCTAGAGCCAAATAAAGTATGTAGCTTATGATTCTGGCAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAA
Notes:	The probe template was PCR amplified from IMAGE:6824341 using vector (pYX-Asc) specific primers. Forward Primer - name:RZPD T3, sequence:ATTAACCCTCACTAAAGGGA; Reverse Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:6824341 which was retrieved directly from NCBI.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:11454 same embryo
	EMAGE:11457 same embryo
	EMAGE:11456 same embryo
	EMAGE:11458 same embryo
	EMAGE:11453 same embryo
	EurExpress:euxassay_006917 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source