Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11878

Lrp4 low density lipoprotein receptor-related protein 4 ( MGI:2442252)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11878 EMAGE:11878 EMAGE:11878 EMAGE:11878 EMAGE:11878
"Pseudo-wholemount" of euxassay_011129. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011129_01 euxassay_011129_02 euxassay_011129_03 euxassay_011129_04
EMAGE:11878 EMAGE:11878 EMAGE:11878 EMAGE:11878 EMAGE:11878
euxassay_011129_05 euxassay_011129_06 euxassay_011129_07 euxassay_011129_08 euxassay_011129_09
EMAGE:11878 EMAGE:11878 EMAGE:11878 EMAGE:11878 EMAGE:11878
euxassay_011129_10 euxassay_011129_11 euxassay_011129_12 euxassay_011129_13 euxassay_011129_14
EMAGE:11878 EMAGE:11878 EMAGE:11878 EMAGE:11878 EMAGE:11878
euxassay_011129_15 euxassay_011129_16 euxassay_011129_17 euxassay_011129_18 euxassay_011129_19
EMAGE:11878 EMAGE:11878 EMAGE:11878
euxassay_011129_20 euxassay_011129_21 euxassay_011129_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11878Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11878_wholemount_strong.wlz
11878_wholemount_moderate.wlz
11878_wholemount_weak.wlz
11878_wholemount_possible.wlz
11878_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11878_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vibrissa
strong strong
regionalstrong expression: see section 19 moderate expression: see section 07 08 09 10 11 20 21
thalamus mantle layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 moderate expression: see section 08 09 16 17
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 16 17 18 19 moderate expression: see section 08 09 10 11 12 13 14 15 20 21 22
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 11 16 17 18 19 moderate expression: see section 08 12 13 14 15
pons ventricular layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 16 17 18
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 12 13 14
alar columns
moderate moderate
regionalmoderate expression: see section 11
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19
tongue epithelium
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17
lower jaw incisor
strong strong
regionalstrong expression: see section 12 15 16
lower jaw molar
strong strong
regionalstrong expression: see section 08 18
upper jaw incisor
strong strong
regionalstrong expression: see section 15 16
upper jaw molar
strong strong
regionalstrong expression: see section 08 18
maturing glomerular tuft
strong strong
regionalstrong expression: see section 08 09 10 11 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36596
Entity Detected:Lrp4, low density lipoprotein receptor-related protein 4 ( MGI:2442252)
Sequence:sense strand is shown

>T36596
CTGGAGGTCACAGGTTAAAAGGTAATGGACAGAGGTTGAGAGAAGGAAGAAGCAGCCCAGCTGGTCTGGG
TGCTTGGGAAACCTCCAGCCTCAAGTGTTGGTAATTATGAAAAACCTTGGGGGGCGGGGATTCGAGCCCT
GGAATCATGTCCATTGCTGGCAGTGGACATTCTCCTCATCCAGAAGTCACTGCTTTGTCAGTTGTGATAC
AGGTGAAGTGTGGGAATGGCTTAGGCTCTTCTTCCTCCTGCTGGAATGTCTGGGGCCATTTCTACCTTGG
ATAACTGGATAGCTCCTGCCATGGCAACTCACTAATAGGAATTCCCTCCTGGTGCTGTGATGGGCCGTAC
TTTTCTTAAGCCTTTAGCTATGCTGTGAGCTTGAGTGAACATTGGGTGGGCCTTGGAGAGCAGACTTGTA
GAACGTTTAAGAAGCTCTGCAAAGAAAGCATAGCATCCTACCCGAGCTTCACCTATTCTACTCTTCTCTC
TTCCATTCTGTGGGATTCTAAGGGAAACAATTCTGTCACAGCCTTTCAAAGACTGGCTCAACATTTTCCT
AAATGGTCAGAAAGAGCAACTAGAGAGACACAAGACACCCAGGGGCTCAGGAGGAGAATTGTGAGGTTGA
ACCTCTTGAGTTCATTCTCAAGTGCTCAGGGATCCAAGTTCATGGACACAGCCTGTGGCTCTCGGGTGGT
AAAGGTCATGTGCCAACTCTTCTCAGCCCCTGTCCACACTAAAGTGCCAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 93489. Forward Primer - name:093489_F_cDNA_Lrp4, sequence:CTGGAGGTCACAGGTTAAAAGG; Reverse Primer - name:093489_N_SP6_cDNA_Lrp4, sequence:CTGGCACTTTAGTGTGGACAGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11875 same embryo
 EMAGE:11874 same embryo
 EMAGE:11876 same embryo
 EMAGE:11877 same embryo
 EMAGE:11879 same embryo
 EurExpress:euxassay_011129 same experiment
 MGI:4825984 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS