Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11946

Lyar Ly1 antibody reactive clone ( MGI:107470)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11946 EMAGE:11946 EMAGE:11946 EMAGE:11946 EMAGE:11946
"Pseudo-wholemount" of euxassay_011091. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011091_01 euxassay_011091_02 euxassay_011091_03 euxassay_011091_04
EMAGE:11946 EMAGE:11946 EMAGE:11946 EMAGE:11946 EMAGE:11946
euxassay_011091_05 euxassay_011091_06 euxassay_011091_07 euxassay_011091_08 euxassay_011091_09
EMAGE:11946 EMAGE:11946 EMAGE:11946 EMAGE:11946 EMAGE:11946
euxassay_011091_10 euxassay_011091_11 euxassay_011091_12 euxassay_011091_13 euxassay_011091_14
EMAGE:11946 EMAGE:11946 EMAGE:11946 EMAGE:11946 EMAGE:11946
euxassay_011091_15 euxassay_011091_16 euxassay_011091_17 euxassay_011091_18 euxassay_011091_19
EMAGE:11946 EMAGE:11946 EMAGE:11946 EMAGE:11946
euxassay_011091_20 euxassay_011091_21 euxassay_011091_22 euxassay_011091_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11946Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11946_wholemount_strong.wlz
11946_wholemount_moderate.wlz
11946_wholemount_weak.wlz
11946_wholemount_possible.wlz
11946_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11946_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
axial musculature
moderate moderate
regionalmoderate expression: see section 05 06 20 21
thymus primordium
moderate moderate
regionalmoderate expression: see section 12 13 14 15
submandibular gland primordium
strong strong
regionalstrong expression: see section 08 09 10 17 18 19
pancreas
moderate moderate
regionalmoderate expression: see section 09 10 11 12 17
vibrissa
moderate moderate
regionalmoderate expression: see section 06 07 09 20 21 22 weak expression: see section 08
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 11 17 18 19
mandible
weak weak
regionalweak expression: see section 04 05 06 09 10 11 12 16 17 18 19 20 21 22
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 16 17
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 09 10
maxilla
weak weak
regionalweak expression: see section 09 10 11 18
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 16 17 18
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 09 10
liver lobe
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 moderate expression: see section 13 14 16 17 18 19 20 21 22 weak expression: see section 15
renal cortex
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 17 18 19 20
testis
weak weak
regionalweak expression: see section 06 07 08 19 20 21
lung
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 14 15 16 17 18 19 20 21 22 weak expression: see section 12
clavicle
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 11 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36607
Entity Detected:Lyar, Ly1 antibody reactive clone ( MGI:107470)
Sequence:sense strand is shown

>T36607
GAAGTGCATCAGTGAAGGTCAGAAGTACGGAGGCAAAGGCTATGAAGCCAAGACACACAAAGGTGATGCA
AAACAGCAGGCATGGATTCAGAAAATTAATGAGTTAATAAAGAAACCCAACGTCAGCCCCAAGGTGCGAG
AACTTTTGCAGCAAATCAGTGCTTTTGATAATGTTCCCAGAAAAAAGGCGAAGTTTCAGAACTGGATGAA
AAACAGCCTGAAAGTGCACAGCGACTCCGTTCTAGAGCAGGTGTGGGATATCTTCTCCGAAGCATCCAGC
AGTGAGCAAGATCAGCAGCAGCCACCCAGCCACACGGCCAAGCCACATGCAGAGATGCCGATCACTAAAG
TTCCATCTGCAAAAACAAATGGCACCACAGAAGAGCAAACCGAGGCGAAGAAGAATAAAAGAGAAAGGAA
GGAGGAACGGCAGAAAAACAGGAAGAAAGAGAAGAAAGAGCTGAAGCTAGAAAACCACCAGGAAAACCTG
AGGGGCCAGAAGCCAAAGAAGCGCAAGAAGAACCAGGAGGCCGGACATGAGGCTGCTGGGGAGGAGGCCG
CCGAGGCCAGCGGCCCACCGGAGAAGAAGAAAGCCCAGGGAGGACAGGCTTCTGAAGAGGGAGCAGACAG
AAATGGGGGCCCTGGGGAGGATGCTGCCGAGGGGCAGACCAAGACAGCAGCAGGGAAACGGAAGCGGCCA
AAGCACTCAGGAGCTGAGTCTGGTTACAAGAAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 64505. Forward Primer - name:064505_F_cDNA_Lyar, sequence:GAAGTGCATCAGTGAAGGTCAG; Reverse Primer - name:064505_N_SP6_cDNA_Lyar, sequence:TTTCTTGTAACCAGACTCAGCTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11944 same embryo
 EMAGE:11942 same embryo
 EMAGE:11943 same embryo
 EMAGE:11945 same embryo
 EMAGE:11941 same embryo
 EurExpress:euxassay_011091 same experiment
 MGI:4826034 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS