Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12015

2900026A02Rik RIKEN cDNA 2900026A02 gene ( MGI:1920194)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12015 EMAGE:12015 EMAGE:12015 EMAGE:12015 EMAGE:12015
"Pseudo-wholemount" of euxassay_011143. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011143_01 euxassay_011143_02 euxassay_011143_03 euxassay_011143_04
EMAGE:12015 EMAGE:12015 EMAGE:12015 EMAGE:12015 EMAGE:12015
euxassay_011143_05 euxassay_011143_06 euxassay_011143_07 euxassay_011143_08 euxassay_011143_09
EMAGE:12015 EMAGE:12015 EMAGE:12015 EMAGE:12015 EMAGE:12015
euxassay_011143_10 euxassay_011143_11 euxassay_011143_12 euxassay_011143_13 euxassay_011143_14
EMAGE:12015 EMAGE:12015 EMAGE:12015 EMAGE:12015 EMAGE:12015
euxassay_011143_15 euxassay_011143_16 euxassay_011143_17 euxassay_011143_18 euxassay_011143_19
EMAGE:12015 EMAGE:12015 EMAGE:12015 EMAGE:12015 EMAGE:12015
euxassay_011143_20 euxassay_011143_21 euxassay_011143_22 euxassay_011143_23 euxassay_011143_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12015Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12015_wholemount_strong.wlz
12015_wholemount_moderate.wlz
12015_wholemount_weak.wlz
12015_wholemount_possible.wlz
12015_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12015_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 11 12 13 14 15
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 17 19 weak expression: see section 18
epidermis
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa epidermal component
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 20 21 22 23 24
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 18 19 21 22 23 24
cornea epithelium
moderate moderate
regionalmoderate expression: see section 04 24
anterior naris epithelium
moderate moderate
regionalmoderate expression: see section 12 13 17 weak expression: see section 15 16
external naris epithelium
moderate moderate
regionalmoderate expression: see section 12 17 weak expression: see section 11
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 12 weak expression: see section 11 15 16 17 18
vomeronasal organ
weak weak
regionalweak expression: see section 15
esophagus epithelium
moderate moderate
regionalmoderate expression: see section 12 13
pharynx epithelium
moderate moderate
regionalmoderate expression: see section 11 13 14 15
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09
rectum
moderate moderate
regionalmoderate expression: see section 13
midgut
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 12
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 19 20
oral epithelium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 16 17 weak expression: see section 12
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 20
bladder
weak weak
regionalweak expression: see section 13
urethra of male
weak weak
regionalweak expression: see section 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37321
Entity Detected:2900026A02Rik, RIKEN cDNA 2900026A02 gene ( MGI:1920194)
Sequence:sense strand is shown

>T37321
CCTCTGCATACACCTCACCATACTCCCTAGGCTGGGAAATCGGCTCTTGGGCTCCTGCCCTGGCAGCCCT
TCGGGAAGGACCTTGACAAACAAGCTTGAATGGCTTTTGGGTTTGCCACCATCAGAGGATTACGCTGGGG
TCTGTCTCGCGGGTTGGGTTTGATTTTTTTCCCCGCCCTTTTTTTTTAAACAAGCTCCCCTTTCCCCACT
AAGAGCCTACCTTCTGACTTCTGACTTATAAGCACAGCTCCGCCCCATCCTGTCCATACCCTTATCCTTC
CTGCGAGGCCCCGTGCACAGTTGGCCTGGGTCGCACGGCTTTCATGTTTGCTTCAGAGGGGCATAAAGCA
ATAATGCAGCCAATTTCCCCTGAACTTTGGCAAAGTGCTTATGTCTCAGCATTGACAGCAGGAAGAGGCA
GGCAGTGTCCGGTTGCCTCCGGTTACCTGATCGCTGTCCAAGCTTACGAAGGCTTGTGACGTTCACCCTT
GTCCACGTCTGGGTTGCTCTGATCTCCGTGGGGGGCAGCCTTTGCCCCCAGTCTCGAGCGTTACGAACCT
TGGTTGGAATTGTCCGTGCCCTGGCCACTCACGTCCTGGACCTGCTCTTTCTGAACACCCATATCCTGCT
GGAGAGAAGACACAACTTAGCTCAGCGGAGCAGACGCGACCCCAACCCCACCTTCCATGGCTCTCCTGGA
CAAGTGATTATCTAGGTCCCATGTGGATGTTGCTCTAACTGAAAGGCCCCTGTACTGGGAGGCCCAGGCC
AGATGCTGGGCCAAGAATGAGGTCTATGGTGTCCTCCATTGTGCTACCTGCATGTTCACTCCAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 67702. Forward Primer - name:067702_F_cDNA_2900026A02Rik, sequence:CCTCTGCATACACCTCACCATA; Reverse Primer - name:067702_N_SP6_cDNA_2900026A02Rik, sequence:CTGGAGTGAACATGCAGGTAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12012 same embryo
 EMAGE:12016 same embryo
 EMAGE:12013 same embryo
 EMAGE:12011 same embryo
 EMAGE:12014 same embryo
 EurExpress:euxassay_011143 same experiment
 MGI:4822694 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS