EMAGE mouse gene expression spatial database

EMAGE:12204

Rps24 ribosomal protein S24 ( MGI:98147)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_007170. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_007170_01	euxassay_007170_02	euxassay_007170_03	euxassay_007170_04

euxassay_007170_05	euxassay_007170_06	euxassay_007170_07	euxassay_007170_08	euxassay_007170_09

euxassay_007170_10	euxassay_007170_11	euxassay_007170_12	euxassay_007170_13	euxassay_007170_14

euxassay_007170_15	euxassay_007170_16	euxassay_007170_17	euxassay_007170_18	euxassay_007170_19

euxassay_007170_20	euxassay_007170_21	euxassay_007170_22	euxassay_007170_23

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T8568
Entity Detected:	Rps24, ribosomal protein S24 ( MGI:98147)
Sequence:	sense strand is shown >T8568 AGCTCCGGCGCCGTAGCCATCATGAATGACACAGTAACCATCCGGACCAGGAAGTTCATGACCAACCGTC TGCTTCAGAGGAAACAGATGGTCATTGATGTCCTTCATCCTGGGAAGGCAACAGTACCAAAGACAGAAAT TCGGGAAAAGCTGGCCAAAATGTACAAAACCACACCAGATGTCATCTTTGTATTTGGATTCAGAACCCAC TTCGGTGGTGGCAAGACCACTGGCTTTGGCATGATCTATGATTCTTTAGATTATGCAAAGAAGAATGAGC CTAAACACAGACTGGCAAGACATGGCCTTTATGAGAAGAAAAAGACCTCCCGAAAACAGCGAAAGGAACG CAAGAACAGAATGAAGAAGGTCAGGGGCACGGCGAAGGCCAATGTTGGTGCTGGCAAAAAGTGAGTGGAG ATTGGATACAGCCAAAGGAGTAGATCTGCGGTGACTTGATGTTTTGCTGTGATGTGCAGATTTCTGAGAG GACAAATAAACTAAAAAGCTCCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Notes:	The probe template was PCR amplified from IMAGE:5712639 using vector (pYX-Asc) specific primers. Forward Primer - name:RZPD T3, sequence:ATTAACCCTCACTAAAGGGA; Reverse Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:5712639 which was retrieved directly from NCBI.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:12208 same embryo
	EMAGE:12203 same embryo
	EMAGE:12207 same embryo
	EMAGE:12206 same embryo
	EMAGE:12205 same embryo
	EurExpress:euxassay_007170 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source