Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12274

Mapk8ip1 mitogen-activated protein kinase 8 interacting protein 1 ( MGI:1309464)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12274 EMAGE:12274 EMAGE:12274 EMAGE:12274 EMAGE:12274
"Pseudo-wholemount" of euxassay_011138. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011138_01 euxassay_011138_02 euxassay_011138_03 euxassay_011138_04
EMAGE:12274 EMAGE:12274 EMAGE:12274 EMAGE:12274 EMAGE:12274
euxassay_011138_05 euxassay_011138_06 euxassay_011138_07 euxassay_011138_08 euxassay_011138_09
EMAGE:12274 EMAGE:12274 EMAGE:12274 EMAGE:12274 EMAGE:12274
euxassay_011138_10 euxassay_011138_11 euxassay_011138_12 euxassay_011138_13 euxassay_011138_14
EMAGE:12274 EMAGE:12274 EMAGE:12274 EMAGE:12274 EMAGE:12274
euxassay_011138_15 euxassay_011138_16 euxassay_011138_17 euxassay_011138_18 euxassay_011138_19
EMAGE:12274 EMAGE:12274 EMAGE:12274 EMAGE:12274
euxassay_011138_20 euxassay_011138_21 euxassay_011138_22 euxassay_011138_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12274Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12274_wholemount_strong.wlz
12274_wholemount_moderate.wlz
12274_wholemount_weak.wlz
12274_wholemount_possible.wlz
12274_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12274_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
facial vii ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 22
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 08 09 20 21
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 19 20 21 22 23
vagus x ganglion
strong strong
regionalstrong expression: see section 09 10 19
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 19 20 21
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 11 18
spinal cord
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 16 17 18 19 20
neural retina
strong strong
regionalstrong expression: see section 01 02 03 04 23
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 15 16 17 18 19 20
vomeronasal organ
strong strong
regionalstrong expression: see section 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36621
Entity Detected:Mapk8ip1, mitogen-activated protein kinase 8 interacting protein 1 ( MGI:1309464)
Sequence:sense strand is shown

>T36621
AAGTACACACTGGTGGTGGATGAACATGCCCAGCTTGAGTTGGTGAGCCTGCGGCCGTGCTTTGGAGATT
ACAGTGACGAAAGCGACTCTGCCACTGTCTATGACAACTGTGCCTCTGCCTCCTCGCCCTACGAGTCAGC
CATTGGTGAGGAGTATGAGGAGGCCCCTCAGCCCCGGCCTCCCACCTGCCTCTCAGAGGACTCCACCCCG
GATGAGCCTGATGTCCACTTCTCTAAGAAGTTTCTGAATGTCTTCATGAGTGGCCGCTCTCGTTCCTCCA
GTGCTGAGTCCTTTGGGCTGTTCTCCTGCGTCATCAATGGGGAGGAGCATGAGCAAACCCATCGGGCTAT
ATTCAGGTTTGTGCCTCGGCATGAAGATGAACTTGAGCTGGAAGTGGATGACCCCCTGCTGGTGGAGCTG
CAGGCAGAAGACTATTGGTATGAGGCCTATAACATGCGCACCGGAGCCCGCGGGGTCTTCCCTGCCTACT
ATGCCATTGAGGTCACCAAGGAGCCTGAGCACATGGCAGCCCTTGCCAAAAACAGCGACTGGATTGACCA
GTTCCGGGTGAAGTTCCTGGGGTCTGTCCAGGTTCCTTATCACAAGGGCAATGATGTCCTCTGTGCTGCT
ATGCAAAAGATCGCCACCACCCGCCGGCTCACCGTGCACTTTAACCCGCCCTCCAGCTGTGTCCTTGAGA
TCAGTGTCAGGGGTGTCAAGATAGGCGTCAAAGCTGATGATGCTCTGGAGGCCAAGGGAAATAAATGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 95899. Forward Primer - name:095899_F_cDNA_Mapk8ip, sequence:AAGTACACACTGGTGGTGGATG; Reverse Primer - name:095899_N_SP6_cDNA_Mapk8ip, sequence:ACATTTATTTCCCTTGGCCTCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12277 same embryo
 EMAGE:12273 same embryo
 EMAGE:12275 same embryo
 EMAGE:12272 same embryo
 EMAGE:12276 same embryo
 EurExpress:euxassay_011138 same experiment
 MGI:4826094 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS