Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12276

Mapk7 mitogen-activated protein kinase 7 ( MGI:1346347)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12276 EMAGE:12276 EMAGE:12276 EMAGE:12276 EMAGE:12276
"Pseudo-wholemount" of euxassay_011137. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011137_01 euxassay_011137_02 euxassay_011137_03 euxassay_011137_04
EMAGE:12276 EMAGE:12276 EMAGE:12276 EMAGE:12276 EMAGE:12276
euxassay_011137_05 euxassay_011137_06 euxassay_011137_07 euxassay_011137_08 euxassay_011137_09
EMAGE:12276 EMAGE:12276 EMAGE:12276 EMAGE:12276 EMAGE:12276
euxassay_011137_10 euxassay_011137_11 euxassay_011137_12 euxassay_011137_13 euxassay_011137_14
EMAGE:12276 EMAGE:12276 EMAGE:12276 EMAGE:12276 EMAGE:12276
euxassay_011137_15 euxassay_011137_16 euxassay_011137_17 euxassay_011137_18 euxassay_011137_19
EMAGE:12276 EMAGE:12276
euxassay_011137_20 euxassay_011137_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12276Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12276_wholemount_strong.wlz
12276_wholemount_moderate.wlz
12276_wholemount_weak.wlz
12276_wholemount_possible.wlz
12276_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12276_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
facial vii ganglion
weak weak
regionalweak expression: see section 05 06 19 20
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 08 18
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 09 17 18 19 20 21
vagus x ganglion
weak weak
regionalweak expression: see section 09 17 18
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 08 17 18
trigeminal v nerve
weak weak
regionalweak expression: see section 10 16
spinal cord
weak weak
regionalweak expression: see section 10 11 12 13 14 15 16
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 10 15
cervical ganglion
weak weak
regionalweak expression: see section 09 10 17
thoracic ganglion
weak weak
regionalweak expression: see section 13
dorsal root ganglion
weak weak
regionalweak expression: see section 09 10 11 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36620
Entity Detected:Mapk7, mitogen-activated protein kinase 7 ( MGI:1346347)
Sequence:sense strand is shown

>T36620
ACAGTATACCCAGGTGCTGACCGCCAGGCCCTCTCCCTGCTGGGACGCATGTTGCGATTTGAACCCAGTG
CCCGAATCTCAGCTGCTGCTGCCCTTCGCCACCCCTTCCTGGCTAAGTACCATGACCCTGATGATGAGCC
TGATTGCGCCCCACCTTTTGACTTTGCTTTTGACCGTGAAGCCCTTACCAGGGAGCGCATTAAGGAGGCC
ATTGTGGCTGAGATTGAGGACTTCCATGCACGACGGGAGGGCATCCGCCAACAAATCCGCTTCCAGCCTT
CTCTGCAGCCTGTGGCTAGTGAGCCTGTGTGTCCAGATGTTGAGATGCCCAGTCCCTGGGCTCCAAGTGG
AGACTGTGCCATGGAGTCGCCTCCTCCAGCACTGCCACCATGCTCTGATCCTGCACCTGACACCGTTGAT
CTGACTCTGCAGCCTGCCCCGCCGGCCAGTGAGCTTGCTCCACCAAAAAGAGAGGGTGCCATCTCCGACA
ATACCAAAGCAGCCCTCAAAGCTGCCCTGCTCAAGTCCCTAAGGAGCAGGCTCAGAGATGGGCCCAGTGC
ACCCTTGGAGGCGCCTGAGCCTCGAAAGCCCGTGACAGCTCAGGAACGCCAGCGAGAACGAGAAGAGAAG
CGCAGGAGGCGACAAGAGAGAGCCAAGGAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 99584. Forward Primer - name:099584_F_cDNA_Mapk7, sequence:ACAGTATACCCAGGTGCTGACC; Reverse Primer - name:099584_N_SP6_cDNA_Mapk7, sequence:GCTCCTTGGCTCTCTCTTGTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12277 same embryo
 EMAGE:12273 same embryo
 EMAGE:12275 same embryo
 EMAGE:12272 same embryo
 EMAGE:12274 same embryo
 EurExpress:euxassay_011137 same experiment
 MGI:4826092 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS