Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12284

Lamc3 laminin gamma 3 ( MGI:1344394)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12284 EMAGE:12284 EMAGE:12284 EMAGE:12284 EMAGE:12284
"Pseudo-wholemount" of euxassay_011060. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011060_01 euxassay_011060_02 euxassay_011060_03 euxassay_011060_04
EMAGE:12284 EMAGE:12284 EMAGE:12284 EMAGE:12284 EMAGE:12284
euxassay_011060_05 euxassay_011060_06 euxassay_011060_07 euxassay_011060_08 euxassay_011060_09
EMAGE:12284 EMAGE:12284 EMAGE:12284 EMAGE:12284 EMAGE:12284
euxassay_011060_10 euxassay_011060_11 euxassay_011060_12 euxassay_011060_13 euxassay_011060_14
EMAGE:12284 EMAGE:12284 EMAGE:12284 EMAGE:12284 EMAGE:12284
euxassay_011060_15 euxassay_011060_16 euxassay_011060_17 euxassay_011060_18 euxassay_011060_19
EMAGE:12284 EMAGE:12284 EMAGE:12284 EMAGE:12284 EMAGE:12284
euxassay_011060_20 euxassay_011060_21 euxassay_011060_22 euxassay_011060_23 euxassay_011060_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12284Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12284_wholemount_strong.wlz
12284_wholemount_moderate.wlz
12284_wholemount_weak.wlz
12284_wholemount_possible.wlz
12284_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12284_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
vibrissa
strong strong
regionalstrong expression: see section 11 21 22 23 moderate expression: see section 08 09 10 20 24
diencephalon meninges
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 06 07 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
midbrain meninges
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
spinal cord meninges
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36580
Entity Detected:Lamc3, laminin gamma 3 ( MGI:1344394)
Sequence:sense strand is shown

>T36580
CTGGCAAGTCTTCAGAAAGGATCCAGCACACCCACCAATTGGAGTCACCTGGCATCAGAGGCCCAGATCC
TTGCCAGAAGCCACAGGGACACGGCCACCAAGATCGAAGCTACCTCGGAAAGGGCCCTGCTCGCCTCCAA
CGCCAGCTATGAGCTCCTGAAGCTGATGGAAGGCAGAGTGGCCTCGGAAGCCCAGCAGGAACTGGAGGAC
AGGTACCAGGAGGTGCAGGCAGCTCAGACTGCCCTGGGCATAGCTGTGGCAGAGGCGCTGCCCAAAGCTG
AAAAGGCACTGGCCACGGTGAAGCAAGTCATTGGTGACGCAGCCCCACATCTAGGCTTGCTGGTCACCCC
TGAAGCAATGAACTTCCAAGCCAGGGGCCTGAGCTGGAAAGTGAAGGCCCTGGAGCAGAAGCTGGAGCAG
AAGGAGCCCGAGGTGGGCCAGTCTGTGGGAGCCCTGCAGGTGGAGGCTGGAAGAGCCTTGGAGAAGATGG
AGCCCTTTATGCAGCTACGCAATAAGACCACAGCTGCCTTCACACGGGCTTCCTCAGCTGTGCAAGCTGC
CAAGGTGACCGTCATAGGAGCAGAGACCCTGCTAGCTGACCTAGAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 90526. Forward Primer - name:090526_F_cDNA_Lamc3, sequence:CTGGCAAGTCTTCAGAAAGGAT; Reverse Primer - name:090526_N_SP6_cDNA_Lamc3, sequence:CTCTAGGTCAGCTAGCAGGGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12283 same embryo
 EMAGE:12287 same embryo
 EMAGE:12285 same embryo
 EMAGE:12286 same embryo
 EurExpress:euxassay_011060 same experiment
 MGI:4825864 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS