Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12296

Corin corin ( MGI:1349451)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12296 EMAGE:12296 EMAGE:12296 EMAGE:12296 EMAGE:12296
"Pseudo-wholemount" of euxassay_011008. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011008_01 euxassay_011008_02 euxassay_011008_03 euxassay_011008_04
EMAGE:12296 EMAGE:12296 EMAGE:12296 EMAGE:12296 EMAGE:12296
euxassay_011008_05 euxassay_011008_06 euxassay_011008_07 euxassay_011008_08 euxassay_011008_09
EMAGE:12296 EMAGE:12296 EMAGE:12296 EMAGE:12296 EMAGE:12296
euxassay_011008_10 euxassay_011008_11 euxassay_011008_12 euxassay_011008_13 euxassay_011008_14
EMAGE:12296 EMAGE:12296 EMAGE:12296 EMAGE:12296 EMAGE:12296
euxassay_011008_15 euxassay_011008_16 euxassay_011008_17 euxassay_011008_18 euxassay_011008_19
EMAGE:12296 EMAGE:12296 EMAGE:12296
euxassay_011008_20 euxassay_011008_21 euxassay_011008_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12296Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12296_wholemount_strong.wlz
12296_wholemount_moderate.wlz
12296_wholemount_weak.wlz
12296_wholemount_possible.wlz
12296_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12296_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata floor plate
strong strong
regionalstrong expression: see section 14
metencephalon floor plate
strong strong
regionalstrong expression: see section 14
midbrain floor plate
strong strong
regionalstrong expression: see section 15 moderate expression: see section 14
spinal cord floor plate
strong strong
regionalstrong expression: see section 15
lower lip
weak weak
regionalweak expression: see section 10 11 12 18 19
upper lip
weak weak
regionalweak expression: see section 09 10 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36184
Entity Detected:Corin, corin ( MGI:1349451)
Sequence:sense strand is shown

>T36184
AAGTTCTGGGACCTGGAGTGTACAGCAATGTGTCTTACTTTGTGGGCTGGATTGAAAGACAAATATATAT
CCAGACCTTTCTCCAAAAGAAATCCCAAGGATAATCAGAGACTTTGTGGGGAAACCTACATGGAGAATGA
CCCTCTGAAACAGAAGCTTGTCCTGCCAAGAGCTGTACGAACAGGCGTTTCACGGACAGGACGCTCAACA
TGCACCGCAAGATCTCTCCTGTTTGTGCTAGATGAGTTTTACTCAGGCTTTAATCTCTTTCAACATTATC
ATTTATTAATTTCATGAATCCTTTTAAAAGCACAGAGCAAAGTAGGTTTTGTTATTTTGCTAGGCTAACC
TTGAATGTAGTGTGCAATTACCAACCCATAGAGACATTTGGAGCTCTAGGGTAACAAGTTATAGAAAGCT
CCTTTTATTACTACTACAAGACACACACGGAGATACACGCTGACTGATCTCCAGTTTCTGCTTAAGCCCA
GTGGCTTAGGGGGCACATTTCAGAACTGATCTTGGAGACTGGCTTTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 100119. Forward Primer - name:100119_F_cDNA_Corin, sequence:AAGTTCTGGGACCTGGAGTGTA; Reverse Primer - name:100119_N_SP6_cDNA_Corin, sequence:AAAAGCCAGTCTCCAAGATCA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12298 same embryo
 EMAGE:12294 same embryo
 EMAGE:12293 same embryo
 EMAGE:12297 same embryo
 EMAGE:12295 same embryo
 EurExpress:euxassay_011008 same experiment
 MGI:4824010 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS