Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12752

Pvalb parvalbumin ( MGI:97821)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12752 EMAGE:12752 EMAGE:12752 EMAGE:12752 EMAGE:12752
"Pseudo-wholemount" of euxassay_011539. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011539_01 euxassay_011539_02 euxassay_011539_03 euxassay_011539_04
EMAGE:12752 EMAGE:12752 EMAGE:12752 EMAGE:12752 EMAGE:12752
euxassay_011539_05 euxassay_011539_06 euxassay_011539_07 euxassay_011539_08 euxassay_011539_09
EMAGE:12752 EMAGE:12752 EMAGE:12752 EMAGE:12752 EMAGE:12752
euxassay_011539_10 euxassay_011539_11 euxassay_011539_12 euxassay_011539_13 euxassay_011539_14
EMAGE:12752 EMAGE:12752 EMAGE:12752 EMAGE:12752 EMAGE:12752
euxassay_011539_15 euxassay_011539_16 euxassay_011539_17 euxassay_011539_18 euxassay_011539_19
EMAGE:12752 EMAGE:12752 EMAGE:12752 EMAGE:12752 EMAGE:12752
euxassay_011539_20 euxassay_011539_21 euxassay_011539_22 euxassay_011539_23 euxassay_011539_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12752Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12752_wholemount_strong.wlz
12752_wholemount_moderate.wlz
12752_wholemount_weak.wlz
12752_wholemount_possible.wlz
12752_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12752_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 15 moderate expression: see section 12 22 23
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 17 21 22 23 weak expression: see section 09 10 11 12 15 16 18 19 20
tegmentum
strong strong
regionalstrong expression: see section 13 14 15 moderate expression: see section 12
trigeminal v ganglion
strong strong
spottedstrong expression: see section 05 06 07 08 09 10 11 moderate expression: see section 19 20 21 22 23
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 19 20 21 22
dorsal root ganglion
strong strong
spottedstrong expression: see section 10 11 12 13 14 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30305
Entity Detected:Pvalb, parvalbumin ( MGI:97821)
Sequence:sense strand is shown

>T30305
TCTGCTCATCCAAGTTGCAGGATGTCGATGACAGACGTGCTCAGCGCTGAGGACATCAAGAAGGCGATAG
GAGCCTTTGCTGCTGCAGACTCCTTCGACCACAAAAAGTTCTTCCAGATGGTGGGCCTGAAGAAAAAGAA
CCCGGATGAGGTGAAGAAGGTGTTCCATATTCTGGACAAAGACAAAAGTGGCTTCATTGAGGAGGATGAG
CTGGGGTCCATTCTGAAGGGCTTCTCCTCAGATGCCAGAGACTTGTCTGCTAAAGAAACAAAGACGCTTC
TGGCCGCTGGAGACAAGGATGGGGACGGCAAGATTGGGGTTGAAGAATTCTCCACTCTGGTGGCTGAAAG
CTAAGTGGCGCTGACTGCTTGGGTCCCCCACCTCTCCATCCCCAACGCCCCATCTCAGCCCTTCTCGCGG
CCCTCCTGAGTTTCTGTTCAGTTTGTTTGTGTTATTTTTTACTCCCCCATCCTCTATGGCCCTCGGATGA
CGCCATTCTTCTGGAAATGCTGGAGAAACAATAAAGGCTGTACCAATCTGACACCACCTGTAGGGAGGAC
CCAGGCCTGGCAGGGTGTTGGTTTGGCAAGTTTTTTTTCTTTCTTTTTAGGGCAGTGGGGGTATAGTAGA
AAAAGTGAGATAAGTCAAAGGACAACGCCCCGATATCTCCTGCCTGCTTGGTACTGAGTGCTCATGTGGG
TCACCTCGTTCAATCTCTGCACCTTTCCCACAAGGAGATGGGGGTGATGGATCGTCCATCTTAAAGATAC
AGAAACTGCCTTTTAAAGAGCAGAAGGGAAGGGAAGGGGTTGAGTCCTTCAGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4925213), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 9685. Forward Primer - name:ABA_MGC_082_02_B02_F_AGGTTCCGGTGATGGACA_ABA_FR_082, sequence:TCTGCTCATCCAAGTTGCAG; Reverse Primer - name:_R_SP6_ABA_MGC_014_02_C03_TCTGCTCATCCAAGTTGCAGGATG, sequence:TCCTGAAGGACTCAACCCC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12753 same embryo
 EMAGE:12751 same embryo
 EMAGE:12748 same embryo
 EMAGE:12750 same embryo
 EMAGE:12749 same embryo
 EurExpress:euxassay_011539 same experiment
 MGI:4827541 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS