Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12922

Col20a1 collagen, type XX, alpha 1 ( MGI:1920618)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12922 EMAGE:12922 EMAGE:12922 EMAGE:12922 EMAGE:12922
"Pseudo-wholemount" of euxassay_013644. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013644_01 euxassay_013644_02 euxassay_013644_03 euxassay_013644_04
EMAGE:12922 EMAGE:12922 EMAGE:12922 EMAGE:12922 EMAGE:12922
euxassay_013644_05 euxassay_013644_06 euxassay_013644_07 euxassay_013644_08 euxassay_013644_09
EMAGE:12922 EMAGE:12922 EMAGE:12922 EMAGE:12922 EMAGE:12922
euxassay_013644_10 euxassay_013644_11 euxassay_013644_12 euxassay_013644_13 euxassay_013644_14
EMAGE:12922 EMAGE:12922 EMAGE:12922 EMAGE:12922 EMAGE:12922
euxassay_013644_15 euxassay_013644_16 euxassay_013644_17 euxassay_013644_18 euxassay_013644_19
EMAGE:12922 EMAGE:12922 EMAGE:12922
euxassay_013644_20 euxassay_013644_21 euxassay_013644_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12922Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12922_wholemount_strong.wlz
12922_wholemount_moderate.wlz
12922_wholemount_weak.wlz
12922_wholemount_possible.wlz
12922_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12922_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 16 17 18 19 20 21
ventral grey horn
weak weak
regionalweak expression: see section 10 11 14 15
otic capsule
weak weak
regionalweak expression: see section 07 08 15 16
nasal septum
moderate moderate
regionalmoderate expression: see section 10 11 12
mandible
moderate moderate
regionalmoderate expression: see section 05 06 07 weak expression: see section 16 17 18
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 12
axial skeleton
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 10 11 12 13
basioccipital bone
moderate moderate
regionalmoderate expression: see section 08 09 10 12
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 08 09 10 12
exoccipital bone
moderate moderate
regionalmoderate expression: see section 03 04 05 06 20 21
temporal bone
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 19 20 21 22 weak expression: see section 18
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 04 05 06 16 17 20 21 22 weak expression: see section 18
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
clavicle
weak weak
regionalweak expression: see section 07 08 15 16 17 18
pelvic girdle skeleton
weak weak
regionalweak expression: see section 07 08 09 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31001
Entity Detected:Col20a1, collagen, type XX, alpha 1 ( MGI:1920618)
Sequence:sense strand is shown

>T31001
GAGAAGGGGGATCAGGGACTTTCAGGCTTGCAGGGCCTCTCTGGCCAGCAAGGCATCCCTGGGAAAACTG
GCCTACAGGGACCAAAGGGCATGAGAGGACTGGAGGGACCTGCTGGCCTGCCAGGACCACCTGGCCCCAG
GGGGTTCCAGGGCTTGGCAGGGGCCAGGGGCACCAATGGGGAGCGAGGAGCCCCAGGAGCTGTGGGTCCC
ACAGGTCTACCAGGGTCCAAAGGTGAACGAGGAGAGAAGGGAGAGCCACAGTCCCTTGCCACCATCTTCC
AGCTGGTGAGCCAGGCCTGCGAGTCAGCCATACGGAGTGAGCCTGTGACTATCAGCCACACAAGCAACCC
TAGACTGCAGGAGGTGCAGACCCCAGAATCCCTGGAGTGAGCAGGATCTTCCCTCCGCCACTTCAAATTG
CCCTGGCCTTCCCCAGCACCATCATCCATAATTTTGTCTCAGCACTAAGAACAACTGTGTGCTGGAGGGG
CAGAGAAGGAAACCCAGAGGAAGACCCCGAGGTGGCAGGAGCTGGAAGGGAGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4481590), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 23286. Forward Primer - name:023286_F_IRAV32-35_H18_1700051I12Rik, sequence:GAGAAGGGGGATCAGGGA; Reverse Primer - name:023286_R_SP6_IRAV32-35_H18_1700051I1, sequence:TCCTCCCTTCCAGCTCCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12921 same embryo
 EMAGE:12924 same embryo
 EMAGE:12919 same embryo
 EMAGE:12920 same embryo
 EMAGE:12923 same embryo
 EurExpress:euxassay_013644 same experiment
 MGI:4823985 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS