Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12974

Emp2 epithelial membrane protein 2 ( MGI:1098726)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12974 EMAGE:12974 EMAGE:12974 EMAGE:12974 EMAGE:12974
"Pseudo-wholemount" of euxassay_013721. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013721_01 euxassay_013721_02 euxassay_013721_03 euxassay_013721_04
EMAGE:12974 EMAGE:12974 EMAGE:12974 EMAGE:12974 EMAGE:12974
euxassay_013721_05 euxassay_013721_06 euxassay_013721_07 euxassay_013721_08 euxassay_013721_09
EMAGE:12974 EMAGE:12974 EMAGE:12974 EMAGE:12974 EMAGE:12974
euxassay_013721_10 euxassay_013721_11 euxassay_013721_12 euxassay_013721_13 euxassay_013721_14
EMAGE:12974 EMAGE:12974 EMAGE:12974 EMAGE:12974 EMAGE:12974
euxassay_013721_15 euxassay_013721_16 euxassay_013721_17 euxassay_013721_18 euxassay_013721_19
EMAGE:12974 EMAGE:12974 EMAGE:12974 EMAGE:12974
euxassay_013721_20 euxassay_013721_21 euxassay_013721_22 euxassay_013721_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12974Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12974_wholemount_strong.wlz
12974_wholemount_moderate.wlz
12974_wholemount_weak.wlz
12974_wholemount_possible.wlz
12974_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12974_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
spottedstrong expression: see section 12 13 14 15 16 17
vibrissa
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 18 19 20 21 22
olfactory cortex mantle layer
moderate moderate
single cellmoderate expression: see section 09 10 11 15 16
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 11 13 14 15 16 17
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 17
medulla oblongata basal plate marginal layer
strong strong
regionalstrong expression: see section 18 19 20
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 13 14 15 16 17
pons ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 18
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 15 moderate expression: see section 16
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 18 19 20 21 22
anterior naris epithelium
strong strong
regionalstrong expression: see section 11 13 14
external naris epithelium
strong strong
regionalstrong expression: see section 10 15
esophagus epithelium
strong strong
regionalstrong expression: see section 14 15
pharynx epithelium
strong strong
regionalstrong expression: see section 13 14 15
tongue epithelium
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 moderate expression: see section 16
tongue muscle
strong strong
regionalstrong expression: see section 13 moderate expression: see section 11 12
stomach
moderate moderate
regionalmoderate expression: see section 06 07 08 09
rectum
moderate moderate
regionalmoderate expression: see section 13 14
midgut
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14
lower jaw incisor
strong strong
regionalstrong expression: see section 11 15
lower jaw molar
strong strong
regionalstrong expression: see section 06 07 18 moderate expression: see section 19
upper jaw incisor
strong strong
regionalstrong expression: see section 11 15
upper jaw molar
strong strong
regionalstrong expression: see section 06 moderate expression: see section 19
bladder
moderate moderate
regionalmoderate expression: see section 13
urethra of male
moderate moderate
regionalmoderate expression: see section 13 14
larynx
strong strong
regionalstrong expression: see section 13 14 15
left lung
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13
right lung
strong strong
regionalstrong expression: see section 14 19 20 21 22 23 moderate expression: see section 16 17 18
trachea
strong strong
regionalstrong expression: see section 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T32047
Entity Detected:Emp2, epithelial membrane protein 2 ( MGI:1098726)
Sequence:sense strand is shown

>T32047
GTGTGGGTACGGCCAAAGGTGGGGAAAGCCAGTCTTTGGGAGCAGACTCTTTGTAGGAGTCTGCCCTTCC
CTCTTCCCCTGCCCACTCCACTCTGACAGCCACAGGTGGAATGATGAGGGCCCAAATGTGGGACCTCTAT
GCTCAGATATTAAACCTAAGCTCACGTAAGAAGTGGGCAAAGACTGGCCCTGGTTTGTCTGTAAGAGACC
CAGAGTTTCCCAACCCCCCTGCCATGAGCTAGGTCATCACACTAATTTGTTGATGTTTGCTCCTGTTTGC
CTTAAGGATAGTGACCCTTGCCTGACGCAGATGTCATGTTTAGGCATTAAGTGTCCATAGGTCATTCCGT
AGGGCATCTAGTACACGTCGGTTCACAAATCTACTTCCAAGACCCTCAGAATCCTTCATTAAAGGGCTGG
GCCTGGGTGTCTGAATTTCTGATGAGCTCCCTGCAATATGGTTAAATGCACTATAACTGGAGGTCAGAGC
CTTAGAACCGGGGGGGAGCAGAGCCACCTTGTAAATGTTACCAGGCTAATCACAATGAGATGGCCCCACT
GCTAGCCACGTCTCAGCCTCCATCAGCTCTTGCTGCCTCTTCCACAGCTGCTTACATCTGGGACACTTGT
GCCCCATTCCCAGGCCATACAAGCCTGGAAGGTGGGCTGGACAGCCTCCTCCCTGACCTACATGGGAAGG
TCTCTCCTTTTCTTCCCGCCCTTTTTTCTAATGTGGATGCTTCCATTAATCCTCTGTTTCTGGAGCCTTG
GAAGATCTGTCTTCCATTCATTCATCCACCCATCCATCATTCAACATGAATGGGTCATGTCACGTGTTGG
GTGCAAGGGATACTCTTTCAAAACAATCCCTCACGAGACTCACAGTCTAGTGAAGAGCACACGCCAGAAA
CCAATTAGAGAAGCTACCAACCACGATGGAACATCAGGGATTCAAAACCTCGGGGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3663158), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 57936. Forward Primer - name:057936_F_IRAV88_d08_Emp2, sequence:GTGTGGGTACGGCCAAAG; Reverse Primer - name:057936_R_SP6_IRAV88_d08_Emp2, sequence:TCACCCCGAGGTTTTGAA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12977 same embryo
 EMAGE:12973 same embryo
 EMAGE:12975 same embryo
 EMAGE:12976 same embryo
 EMAGE:12972 same embryo
 EurExpress:euxassay_013721 same experiment
 MGI:4824545 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS