Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12975

Lpin1 lipin 1 ( MGI:1891340)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12975 EMAGE:12975 EMAGE:12975 EMAGE:12975 EMAGE:12975
"Pseudo-wholemount" of euxassay_013747. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013747_01 euxassay_013747_02 euxassay_013747_03 euxassay_013747_04
EMAGE:12975 EMAGE:12975 EMAGE:12975 EMAGE:12975 EMAGE:12975
euxassay_013747_05 euxassay_013747_06 euxassay_013747_07 euxassay_013747_08 euxassay_013747_09
EMAGE:12975 EMAGE:12975 EMAGE:12975 EMAGE:12975 EMAGE:12975
euxassay_013747_10 euxassay_013747_11 euxassay_013747_12 euxassay_013747_13 euxassay_013747_14
EMAGE:12975 EMAGE:12975 EMAGE:12975 EMAGE:12975 EMAGE:12975
euxassay_013747_15 euxassay_013747_16 euxassay_013747_17 euxassay_013747_18 euxassay_013747_19
EMAGE:12975 EMAGE:12975 EMAGE:12975 EMAGE:12975
euxassay_013747_20 euxassay_013747_21 euxassay_013747_22 euxassay_013747_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12975Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12975_wholemount_strong.wlz
12975_wholemount_moderate.wlz
12975_wholemount_weak.wlz
12975_wholemount_possible.wlz
12975_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12975_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 13 14
medulla oblongata floor plate
moderate moderate
regionalmoderate expression: see section 13 14 15
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 17
metencephalon floor plate
moderate moderate
regionalmoderate expression: see section 13 14 15
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 22
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 09 21
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 10
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 09 21
spinal cord
weak weak
regionalweak expression: see section 13 14 15 16 17 18 19
spinal cord marginal layer
strong strong
regionalstrong expression: see section 14
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 15 16
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 12 18
cervical ganglion
weak weak
regionalweak expression: see section 11 19
thoracic ganglion
weak weak
regionalweak expression: see section 14 17
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 13 17 18 19 21 weak expression: see section 10 11 12 20
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 15 16 17 18
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 15 16
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 20
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 11 15 16
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 20
liver
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T32043
Entity Detected:Lpin1, lipin 1 ( MGI:1891340)
Sequence:sense strand is shown

>T32043
ATCTCGAGTCCTTGGGGGCGGCAGCCCCACCTTCACCCGTGGCCGAAGAGCTCAAGGCCCCATATCCCAA
CACCACACAGTCGTCGAGCAAGACAGATTCCCCTTCCAGGAAGAAAGATAAACGGAGCCGACACCTTGGA
GCTGATGGTGTTTATCTGGACGACCTCACGGACATGGACCCTGAAGTGGCAGCCCTGTATTTCCCCAAGA
ATGGGGATCCTGGGGGGCTCCCCAAACAAGCCAGTGACAACGGAGCCAGGTCAGCCAACCAGTCACCACA
GTCGGTGGGAGGCTCGGGCATCGACAGTGGTGTGGAGAGCACCTCCGACAGCCTGAGGGACCTGCCATCC
ATCGCCATCTCCCTCTGCGGTGGCCTCAGTGACCACAGAGAGATCACCAAAGATGCATTTTTGGAACAAG
CCGTGTCATATCAGCAATTTGCCGACAACCCTGCTATCATCGATGACCCCAACCTCGTGGTCAAGGTTGG
CAATAAGTATTACAACTGGACAACAGCAGCTCCTCTACTTCTGGCGATGCAGGCTTTCCAGAAACCTTTG
CCAAAGGCCACTGTGGAATCCATCATGAGAGATAAGATGCCCAAAAAGGGAGGAAGATGGTGGTTTTCCT
GGAGAGGAAGAAATGCCACAATCAAAGAGGAAAGCAAGCCTGAACAGTGCCTGACTGGGAAAGGCCACAA
TACCGGAGAGCAGCCTGCCCAGCTTGGCCTGGCCACCAGGATAAAGCATGAGTCATCCTCCAGTGATGAA
GAGCACGCAGCCGCCAAGCCATCAGGTTCGAGCCACCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4211202), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 57800. Forward Primer - name:057800_F_IRAV88_a10_Lpin1, sequence:ATCTCGAGTCCTTGGGGG; Reverse Primer - name:057800_R_SP6_IRAV88_a10_Lpin1, sequence:GAGGTGGCTCGAACCTGA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12974 same embryo
 EMAGE:12977 same embryo
 EMAGE:12973 same embryo
 EMAGE:12976 same embryo
 EMAGE:12972 same embryo
 EurExpress:euxassay_013747 same experiment
 MGI:4825970 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS