Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13031

Aspa aspartoacylase ( MGI:87914)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13031 EMAGE:13031 EMAGE:13031 EMAGE:13031 EMAGE:13031
"Pseudo-wholemount" of euxassay_013641. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013641_01 euxassay_013641_02 euxassay_013641_03 euxassay_013641_04
EMAGE:13031 EMAGE:13031 EMAGE:13031 EMAGE:13031 EMAGE:13031
euxassay_013641_05 euxassay_013641_06 euxassay_013641_07 euxassay_013641_08 euxassay_013641_09
EMAGE:13031 EMAGE:13031 EMAGE:13031 EMAGE:13031 EMAGE:13031
euxassay_013641_10 euxassay_013641_11 euxassay_013641_12 euxassay_013641_13 euxassay_013641_14
EMAGE:13031 EMAGE:13031 EMAGE:13031 EMAGE:13031 EMAGE:13031
euxassay_013641_15 euxassay_013641_16 euxassay_013641_17 euxassay_013641_18 euxassay_013641_19
EMAGE:13031 EMAGE:13031 EMAGE:13031 EMAGE:13031 EMAGE:13031
euxassay_013641_20 euxassay_013641_21 euxassay_013641_22 euxassay_013641_23 euxassay_013641_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13031Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13031_wholemount_strong.wlz
13031_wholemount_moderate.wlz
13031_wholemount_weak.wlz
13031_wholemount_possible.wlz
13031_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13031_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 07 08 09 10 17 18 19 20
vibrissa
weak weak
regionalweak expression: see section 05 06 07 08 19 20 21 22
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 17 18
pons mantle layer
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 07
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 21 22
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 20
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 18 19 20 21 22 23
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09 19
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 20 21
ventral grey horn
weak weak
regionalweak expression: see section 12 13 14 16 17
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 16 17 18 19 20
cornea
moderate moderate
regionalmoderate expression: see section 01 02 03 04
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 24 weak expression: see section 23
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 08 09 10 11 12 15 16 17
vomeronasal organ
weak weak
regionalweak expression: see section 12 14
mandible
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 16 17 18 19 20 21
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 11 12 13 15 16 17
maxilla
weak weak
regionalweak expression: see section 05 06 07 08 09 19 20
upper jaw incisor
weak weak
regionalweak expression: see section 11 12 15 16
metanephros
weak weak
regionalweak expression: see section 08 09 20 21
testis
weak weak
regionalweak expression: see section 06 07 08 09 20 21 22 23
urethra of male
weak weak
regionalweak expression: see section 12 13 14
lung
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 23 24
nucleus pulposus
moderate moderate
regionalmoderate expression: see section 14 15
clavicle
weak weak
regionalweak expression: see section 11 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T868
Entity Detected:Aspa, aspartoacylase ( MGI:87914)
Sequence:sense strand is shown

>T868
CCTCGAGNCTGTTGGCCTACTGGAGGAGACAAACTGTACACAGTAACAAGAAATCAGACAGGATCTTGGT
ATTTGTTAAAATGACCTCTTGTGTTGCTAAAGAACCTATTAAGAAGATTGCCATCTTTGGAGGGACTCAT
GGAAATGAACTGACCGGAGTGTTTCTAGTTACTCACTGGCTAAGGAATGGCACTGAAGTTCACAGAGCAG
GGCTGGACGTGAAGCCATTCATTACCAATCCAAGGGCGGTGGAGAAGTGCACCAGATACATTGACTGTGA
CCTGAATCGTGTTTTTGACCTTGAAAATCTTAGCAAAGAGATGACTGAAGACTTGCCATATGAAGTGAGA
AGGGCTCAAGAAATAAATCATTTATTTGGTCCAAAAAATAGTGATGATGCCTATGACCTTGTTTTTGACC
TTCACAACACCACTTCTAACATGGGTTGCACTCTTATTCTTGAGGATTCCAGGAATGACTTTTTAATTCA
GATGTTTCACTATATTAAGACTTGCATGGCTCCATTACCCTGCTCTGTTTATCTCATTGAGCATCCTTCA
CTCAAATAT
Notes:The probe template was PCR amplified from IMAGE:1923601 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1923601 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13032 same embryo
 EMAGE:13033 same embryo
 EMAGE:13030 same embryo
 EurExpress:euxassay_013641 same experiment
 MGI:4823280 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS