Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13595

Mir146b microRNA 146b ( MGI:3629945)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13595 EMAGE:13595 EMAGE:13595 EMAGE:13595 EMAGE:13595
"Pseudo-wholemount" of euxassay_019203. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019203_01 euxassay_019203_02 euxassay_019203_03 euxassay_019203_04
EMAGE:13595 EMAGE:13595 EMAGE:13595 EMAGE:13595 EMAGE:13595
euxassay_019203_05 euxassay_019203_06 euxassay_019203_07 euxassay_019203_08 euxassay_019203_09
EMAGE:13595 EMAGE:13595 EMAGE:13595 EMAGE:13595 EMAGE:13595
euxassay_019203_10 euxassay_019203_11 euxassay_019203_12 euxassay_019203_13 euxassay_019203_14
EMAGE:13595 EMAGE:13595 EMAGE:13595 EMAGE:13595 EMAGE:13595
euxassay_019203_15 euxassay_019203_16 euxassay_019203_17 euxassay_019203_18 euxassay_019203_19
EMAGE:13595 EMAGE:13595 EMAGE:13595 EMAGE:13595 EMAGE:13595
euxassay_019203_20 euxassay_019203_21 euxassay_019203_22 euxassay_019203_23 euxassay_019203_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13595Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13595_wholemount_strong.wlz
13595_wholemount_moderate.wlz
13595_wholemount_weak.wlz
13595_wholemount_possible.wlz
13595_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13595_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70276
Entity Detected:Mir146b, microRNA 146b ( MGI:3629945)
Sequence:sense strand is shown

>T70276
TGAGAACTGAATTCCATAGGCT
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-146b was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13594 same embryo
 EMAGE:13597 same embryo
 EMAGE:13596 same embryo
 EMAGE:13599 same embryo
 EMAGE:13598 same embryo
 EurExpress:euxassay_019203 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS