Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13598

Mir145 microRNA 145 ( MGI:2676830)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13598 EMAGE:13598 EMAGE:13598 EMAGE:13598 EMAGE:13598
"Pseudo-wholemount" of euxassay_019231. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019231_01 euxassay_019231_02 euxassay_019231_03 euxassay_019231_04
EMAGE:13598 EMAGE:13598 EMAGE:13598 EMAGE:13598 EMAGE:13598
euxassay_019231_05 euxassay_019231_06 euxassay_019231_07 euxassay_019231_08 euxassay_019231_09
EMAGE:13598 EMAGE:13598 EMAGE:13598 EMAGE:13598 EMAGE:13598
euxassay_019231_10 euxassay_019231_11 euxassay_019231_12 euxassay_019231_13 euxassay_019231_14
EMAGE:13598 EMAGE:13598 EMAGE:13598 EMAGE:13598 EMAGE:13598
euxassay_019231_15 euxassay_019231_16 euxassay_019231_17 euxassay_019231_18 euxassay_019231_19
EMAGE:13598 EMAGE:13598 EMAGE:13598 EMAGE:13598 EMAGE:13598
euxassay_019231_20 euxassay_019231_21 euxassay_019231_22 euxassay_019231_23 euxassay_019231_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13598Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13598_wholemount_strong.wlz
13598_wholemount_moderate.wlz
13598_wholemount_weak.wlz
13598_wholemount_possible.wlz
13598_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13598_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
single cellmoderate expression: see section 09 10 13 14 15 16 17 18 19 weak expression: see section 08 11 12
telencephalon mantle layer
moderate moderate
single cellmoderate expression: see section 09 13 14 15 16 17 18 19 20 21 22 23 24 weak expression: see section 03 04 05 06 07 10 11 12
olfactory cortex mantle layer
moderate moderate
single cellmoderate expression: see section 13 15 16 17 18 weak expression: see section 10 11
medulla oblongata alar plate mantle layer
moderate moderate
single cellmoderate expression: see section 09 10 16 17 18 19 20 weak expression: see section 08 11
medulla oblongata basal plate mantle layer
moderate moderate
single cellmoderate expression: see section 09 10 13 14 15 16 17 18 19 weak expression: see section 11 12
rest of cerebellum mantle layer
moderate moderate
single cellmoderate expression: see section 09 15 16 17 18 19 20 21 22 weak expression: see section 06
pons mantle layer
moderate moderate
single cellmoderate expression: see section 09 13 14 15 16 17 18 19 20 weak expression: see section 07 08 10 11 12
midbrain mantle layer
moderate moderate
single cellmoderate expression: see section 09 13 14 15 16 17 18 19 20 weak expression: see section 07 08 10 11 12
facial vii ganglion
moderate moderate
single cellmoderate expression: see section 22
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 05 06 07 08 09 10 18 19 20 21 22 23 24
dorsal grey horn
moderate moderate
single cellmoderate expression: see section 15
ventral grey horn
moderate moderate
single cellmoderate expression: see section 13 14 15 16 17 18 19
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 13 19 20
esophagus
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 14 16
stomach
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 moderate expression: see section 03 04 05 06 weak expression: see section 02
hindgut
moderate moderate
regionalmoderate expression: see section 15 16 17 weak expression: see section 14
midgut
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 moderate expression: see section 15 16 17 18 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70274
Entity Detected:Mir145, microRNA 145 ( MGI:2676830)
Sequence:sense strand is shown

>T70274
GTCCAGTTTTCCCAGGAATCCCT
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-145 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13594 same embryo
 EMAGE:13597 same embryo
 EMAGE:13596 same embryo
 EMAGE:13599 same embryo
 EMAGE:13595 same embryo
 EurExpress:euxassay_019231 same experiment
 MGI:4826219 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS