EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13675

Mir181a-1 microRNA 181a-1 ( MGI:3629589)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_019218. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_019218_01	euxassay_019218_02	euxassay_019218_03	euxassay_019218_04

euxassay_019218_05	euxassay_019218_06	euxassay_019218_07	euxassay_019218_08	euxassay_019218_09

euxassay_019218_10	euxassay_019218_11	euxassay_019218_12	euxassay_019218_13	euxassay_019218_14

euxassay_019218_15	euxassay_019218_16	euxassay_019218_17	euxassay_019218_18	euxassay_019218_19

euxassay_019218_20	euxassay_019218_21	euxassay_019218_22	euxassay_019218_23	euxassay_019218_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

	strong
	moderate
	weak
	possible
	not detected

wholemount mapping

Download individual expression domains:

13675_wholemount_strong.wlz

13675_wholemount_moderate.wlz

13675_wholemount_weak.wlz

13675_wholemount_possible.wlz

13675_wholemount_not_detected.wlz

(what is wlz format?)

Download all expression domains:

EMAGE:13675_all_domains.zip

Find spatially similar wholemount expression patterns:

EMAGE spatially similar wholemount patterns

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

intermediate grey horn

weak

regional

weak expression: see section 18

lower lip

weak

regional

weak expression: see section 19

upper lip

moderate

regional

moderate expression: see section 12 13 15 16 weak expression: see section 10 11 14 17 18 19

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T70291
Entity Detected:	Mir181a-1, microRNA 181a-1 ( MGI:3629589)
Sequence:	sense strand is shown >T70291 AACATTCAACGCTGTCGGTGAGT
Notes:	The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-181a was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:	LNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:13676 same assay
	EMAGE:13678 same embryo
	EMAGE:13674 same embryo
	EurExpress:euxassay_019218 same experiment
	MGI:4826224 same experiment
	MGI:4826223 same experiment
	EMAGE:13677 same embryo
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source