Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13677

mmu-miR-181b (mmu-miR-181b)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13677 EMAGE:13677 EMAGE:13677 EMAGE:13677 EMAGE:13677
"Pseudo-wholemount" of euxassay_019219. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019219_01 euxassay_019219_02 euxassay_019219_03 euxassay_019219_04
EMAGE:13677 EMAGE:13677 EMAGE:13677 EMAGE:13677 EMAGE:13677
euxassay_019219_05 euxassay_019219_06 euxassay_019219_07 euxassay_019219_08 euxassay_019219_09
EMAGE:13677 EMAGE:13677 EMAGE:13677 EMAGE:13677 EMAGE:13677
euxassay_019219_10 euxassay_019219_11 euxassay_019219_12 euxassay_019219_13 euxassay_019219_14
EMAGE:13677 EMAGE:13677 EMAGE:13677 EMAGE:13677 EMAGE:13677
euxassay_019219_15 euxassay_019219_16 euxassay_019219_17 euxassay_019219_18 euxassay_019219_19
EMAGE:13677 EMAGE:13677 EMAGE:13677 EMAGE:13677 EMAGE:13677
euxassay_019219_20 euxassay_019219_21 euxassay_019219_22 euxassay_019219_23 euxassay_019219_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13677Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13677_wholemount_strong.wlz
13677_wholemount_moderate.wlz
13677_wholemount_weak.wlz
13677_wholemount_possible.wlz
13677_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13677_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
mesenchyme
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 09 10 11 12 13 17 19 21 22 23 24
lower lip
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 19 weak expression: see section 10
upper lip
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 19 22 weak expression: see section 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70292
Entity Detected:mmu-miR-181b, (mmu-miR-181b)
Sequence:sense strand is shown

>T70292
AACATTCAACGCTGGTGAGT
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-181b was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13678 same embryo
 EMAGE:13674 same embryo
 EMAGE:13675 same embryo
 EMAGE:13676 same embryo
 EurExpress:euxassay_019219 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS