Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14002

Tle1 transducin-like enhancer of split 1, homolog of Drosophila E(spl) ( MGI:104636)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14002 EMAGE:14002 EMAGE:14002 EMAGE:14002 EMAGE:14002
"Pseudo-wholemount" of euxassay_001673. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001673_01 euxassay_001673_02 euxassay_001673_03 euxassay_001673_04
EMAGE:14002 EMAGE:14002 EMAGE:14002 EMAGE:14002 EMAGE:14002
euxassay_001673_05 euxassay_001673_06 euxassay_001673_07 euxassay_001673_08 euxassay_001673_09
EMAGE:14002 EMAGE:14002 EMAGE:14002 EMAGE:14002 EMAGE:14002
euxassay_001673_10 euxassay_001673_11 euxassay_001673_12 euxassay_001673_13 euxassay_001673_14
EMAGE:14002 EMAGE:14002 EMAGE:14002 EMAGE:14002 EMAGE:14002
euxassay_001673_15 euxassay_001673_16 euxassay_001673_17 euxassay_001673_18 euxassay_001673_19
EMAGE:14002 EMAGE:14002 EMAGE:14002
euxassay_001673_20 euxassay_001673_21 euxassay_001673_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14002Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14002_wholemount_strong.wlz
14002_wholemount_moderate.wlz
14002_wholemount_weak.wlz
14002_wholemount_possible.wlz
14002_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14002_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
pituitary gland
moderate moderate
regionalmoderate expression: see section 09 11 12 13 14 15
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 05 06 07 08 09 11 14 15 16 17 18 19 20 21 22
metencephalon rest of alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 14 15 16 17 18 19 20
facial vii ganglion
weak weak
regionalweak expression: see section 04 19
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 05 06 16 17
trigeminal v ganglion
weak weak
regionalweak expression: see section 02 03 04 05 06 07 16 17 18 19
vagus x ganglion
weak weak
regionalweak expression: see section 07
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 05 06 07 16 17
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 15 16
not examined not examined
regionalnot examined expression: see section 01 02 20 21
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 21 weak expression: see section 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2702
Entity Detected:Tle1, transducin-like enhancer of split 1, homolog of Drosophila E(spl) ( MGI:104636)
Sequence:sense strand is shown

>T2702
TGGCCTCGAGGCCAGATTCGGCACGAGGGGTTTTGATCCTCCTCCTCACATGAGAGTACCTTCTATCCCC
CCCAACCTGGCAGGAATACCTGGAGGGAAACCAGCATACTCCTTCCACGTTACTGCTGATGGCCAAATGC
AGCCTGTTCCTTTTCCCCCTGATGCCCTCATTGGACCTGGGATTCCCCGACATGCTCGGCAGATCAACAC
CCTCAACCACGGGGAGGTGGTGTGTGCAGTGACCATCAGCAACCCCACAAGGCACGTGTACACAGGTGGC
AAGGGCTGCGTTAAGGTGTGGGACATCAGCCACCCCGGCAACAAGAGCCCCGTCTCTCAGCTGGATTGTC
TGAATAGAGATAACTACATCCGTTCCTGTAAATTGCTACCTGATGGCTGTACTCTCATAGTGGGAGGGGA
AGCCAGTACTCTATCCATCTGGGACTTGGCAGCTCCAACTCCCCGCATAAAGGCAGAGCTGACATCCTCA
GCCCCTGCCTGTTATGCTCTGGCCATCAGCCCCGACTCCAAGGTCTGCTTCTCATGCTGCAGTGACGGCA
ACATCGCAGTGTG
Notes:The probe template was PCR amplified from IMAGE:1512304 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1512304 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14001 same embryo
 EMAGE:14000 same embryo
 EMAGE:14004 same embryo
 EMAGE:14003 same embryo
 EMAGE:14005 same embryo
 EurExpress:euxassay_001673 same experiment
 MGI:4828733 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS