Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15147

Zfp664 zinc finger protein 664 ( MGI:2442505)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15147 EMAGE:15147 EMAGE:15147 EMAGE:15147 EMAGE:15147
"Pseudo-wholemount" of euxassay_010335. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010335_01 euxassay_010335_02 euxassay_010335_03 euxassay_010335_04
EMAGE:15147 EMAGE:15147 EMAGE:15147 EMAGE:15147 EMAGE:15147
euxassay_010335_05 euxassay_010335_06 euxassay_010335_07 euxassay_010335_08 euxassay_010335_09
EMAGE:15147 EMAGE:15147 EMAGE:15147 EMAGE:15147 EMAGE:15147
euxassay_010335_10 euxassay_010335_11 euxassay_010335_12 euxassay_010335_13 euxassay_010335_14
EMAGE:15147 EMAGE:15147 EMAGE:15147 EMAGE:15147 EMAGE:15147
euxassay_010335_15 euxassay_010335_16 euxassay_010335_17 euxassay_010335_18 euxassay_010335_19
EMAGE:15147 EMAGE:15147 EMAGE:15147 EMAGE:15147 EMAGE:15147
euxassay_010335_20 euxassay_010335_21 euxassay_010335_22 euxassay_010335_23 euxassay_010335_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15147Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15147_wholemount_strong.wlz
15147_wholemount_moderate.wlz
15147_wholemount_weak.wlz
15147_wholemount_possible.wlz
15147_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15147_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 10 11 12 13 14
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 17 18 19 20
thyroid gland
weak weak
regionalweak expression: see section 10 13 14
vibrissa
moderate moderate
regionalmoderate expression: see section 07 08 09 22 23
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 18 19 20 21 22 23
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 09 17 18 19
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 15
cervical ganglion
moderate moderate
regionalmoderate expression: see section 08 16
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 13 14
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16
inner ear
moderate moderate
regionalmoderate expression: see section 02 03 04
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 04 22 23 24
neural retina
moderate moderate
regionalmoderate expression: see section 02 03 04 05 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 16 17 18 19 20 21
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 13 14 16
stomach
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 15 16
lower jaw molar
moderate moderate
regionalmoderate expression: see section 08 09 19 20
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 13
upper jaw molar
moderate moderate
regionalmoderate expression: see section 08 09 19 20
metanephros
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 16 17 18 19
left lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12
right lung
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37573
Entity Detected:Zfp664, zinc finger protein 664 ( MGI:2442505)
Sequence:sense strand is shown

>T37573
AGGTGTGGTGATTCCTGAGACTGGCAACATGCCACAGAGTTGAAATAATACTCAGAACTCAGGAGCCTTG
CCCAGCCGCTCAGTCACCTGCCTGCTGTGCTTCCGGGCAGTGCCAGGCACTCCCTTGTGGGGCTCATGCT
CCTTCTACCTACCGGTCAGTGCATTCAGAAGTGGACAGCTCCCGGAAGGCCGAGTTCTGGTATTGCTGAG
GTTGCCCTGACATAGCTTTCCATGTATCCTGTTATTTCTGAATCCACCTTACCTCATGTCCTCAGAGTAC
CTATAAACACTTACCCCTTCCTAGATGGCATTAAACTCCATTCTAGATGTTAGGAAAGTTGTAACATGCA
CACTCACTCAGCCGATCAGGAATCATTGGCAGATGCACATGCCCTGGAACTTTCCCTTAGTTTTGTGAAC
TCTGCTAATCACTGTGTCTCTAAGTTAGACTTATTTTCTAGTGGCTTCAACACATGTTCCAACTTGAATT
TTTTTCTTTTCTTCTTTAAGTAGCTGAATGTATATATCAGGGAGGAAGAAGCAAGCAAAACTGAGCTTGC
CTTCTTCAAGAGTGACCCTTTCGGGCTCCTTTTTTAGGTGGTGGGATTGAGTCCCTACTAGCTCGGAAGG
CCTTGAGAGGGCTGATGGGGAAGTCACTGAGGATGAATCTGTCATCTCAGGCAATAATGTGTAGGTGTCA
CCATGAGTCACAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 78943. Forward Primer - name:078943_F_cDNA_AW060232, sequence:AGGTGTGGTGATTCCTGAGACT; Reverse Primer - name:078943_N_SP6_cDNA_AW060232, sequence:ATGTGACTCATGGTGACACCTAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15148 same embryo
 EMAGE:15149 same embryo
 EMAGE:15146 same embryo
 EMAGE:15145 same embryo
 EMAGE:15150 same embryo
 EurExpress:euxassay_010335 same experiment
 MGI:4829330 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS