Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15198

Ndfip1 Nedd4 family interacting protein 1 ( MGI:1929601)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15198 EMAGE:15198 EMAGE:15198 EMAGE:15198 EMAGE:15198
"Pseudo-wholemount" of euxassay_010361. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010361_01 euxassay_010361_02 euxassay_010361_03 euxassay_010361_04
EMAGE:15198 EMAGE:15198 EMAGE:15198 EMAGE:15198 EMAGE:15198
euxassay_010361_05 euxassay_010361_06 euxassay_010361_07 euxassay_010361_08 euxassay_010361_09
EMAGE:15198 EMAGE:15198 EMAGE:15198 EMAGE:15198 EMAGE:15198
euxassay_010361_10 euxassay_010361_11 euxassay_010361_12 euxassay_010361_13 euxassay_010361_14
EMAGE:15198 EMAGE:15198 EMAGE:15198 EMAGE:15198 EMAGE:15198
euxassay_010361_15 euxassay_010361_16 euxassay_010361_17 euxassay_010361_18 euxassay_010361_19
EMAGE:15198 EMAGE:15198 EMAGE:15198 EMAGE:15198
euxassay_010361_20 euxassay_010361_21 euxassay_010361_22 euxassay_010361_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15198Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15198_wholemount_strong.wlz
15198_wholemount_moderate.wlz
15198_wholemount_weak.wlz
15198_wholemount_possible.wlz
15198_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15198_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 02 03 15 16 17 18 19 weak expression: see section 04
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 02 03 17 18 19 weak expression: see section 06
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 04 15
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 15 16 17 18 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 04 05 14 15
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 04 05 06
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 08 09 16
spinal cord
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 06 07 11 12
cervical ganglion
weak weak
regionalweak expression: see section 06 13 14
thoracic ganglion
weak weak
regionalweak expression: see section 08 09 10 11
dorsal root ganglion
strong strong
regionalstrong expression: see section 04 moderate expression: see section 03 05 06 07 08 09 10 11 12 13 14 15 16
neural retina
moderate moderate
regionalmoderate expression: see section 02 03 04 22 23
stomach
weak weak
spottedweak expression: see section 04 05 06 07 08 09
midgut
weak weak
spottedweak expression: see section 10 11 12 13 14 15 16 17 18 19 20
mandible
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 17 18 19
maxilla
weak weak
regionalweak expression: see section 06 07 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30228
Entity Detected:Ndfip1, Nedd4 family interacting protein 1 ( MGI:1929601)
Sequence:sense strand is shown

>T30228
AGAACGTCTCAGCGTCGGCAGCGTCCGTCCACACACGCCCCGGCGCGTACCTTTCGGCCTCCCGGCGACC
CCCAGCCGCGGCGCTCGCGCCCGATCAGCTCTCTCGCTCGCCCTCCTTCCCTGAGGCCCGCTGCGCCATG
GCCTTGGCGTTGGCGGCGCTGGCGGCCGTGGAGCCGGCCTGCGGCAGCGGGTACCAGCAGTTGCAGAATG
AAGAGGAGCCTGGGGAACCTGAGCAGACTGCAGGTGATGCTCCTCCACCATACAGCAGCATCACTGCAGA
GAGTGCAGCATATTTTGACTACAAAGATGAATCTGGATTTCCAAAGCCCCCATCGTATAATGTGGCTACA
ACACTGCCCAGTTATGACGAGGCTGAGAGAACCAAGACTGAAGCTACGATCCCTTTGGTTCCTGGAAGAG
ATGAAGATTTTGTGGGCCGGGATGATTTTGATGATACTGACCAGCTGAGGATAGGAAACGATGGGATTTT
TATGTTAACTTTTTTCATGGCATTCCTCTTCAACTGGATTGGGTTTTTCTTGTCTTTTTGCCTGACCACC
TCAGCTGCGGGAAGGTATGGGGCCATCTCAGGATTTGGTCTTTCTCTAATTAAGTGGATCCTTATTGTCA
GGTTTTCCACCTATTTCCCTGGATACTTTGATGGCCAGTACTGGCTCTGGTGGGTGTTCTTGGTTTTAGG
CTTTCTCCTGTTTCTCAGAGGATTTATCAATTACGCAAAAGTTCGGAAGATGCCAGAAACTTTCTCAAAT
CTCCCCAGGACCAGAGTTCTCTTTATTTATTAAAGATGTTTTCTGGCAAAGGCTTCCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4162070), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 9624. Forward Primer - name:009624_F_IRAV59-62_D15_Ndfip1, sequence:AGAACGTCTCAGCGTCGG; Reverse Primer - name:009624_R_SP6_IRAV59-62_D15_Ndfip1, sequence:CAGGAAGCCTTTGCCAGA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15195 same embryo
 EMAGE:15194 same embryo
 EMAGE:15193 same embryo
 EMAGE:15196 same embryo
 EMAGE:15197 same embryo
 EurExpress:euxassay_010361 same experiment
 MGI:4826628 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS