Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15434

D8Ertd738e DNA segment, Chr 8, ERATO Doi 738, expressed ( MGI:1289231)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15434 EMAGE:15434 EMAGE:15434 EMAGE:15434 EMAGE:15434
"Pseudo-wholemount" of euxassay_010646. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010646_01 euxassay_010646_02 euxassay_010646_03 euxassay_010646_04
EMAGE:15434 EMAGE:15434 EMAGE:15434 EMAGE:15434 EMAGE:15434
euxassay_010646_05 euxassay_010646_06 euxassay_010646_07 euxassay_010646_08 euxassay_010646_09
EMAGE:15434 EMAGE:15434 EMAGE:15434 EMAGE:15434 EMAGE:15434
euxassay_010646_10 euxassay_010646_11 euxassay_010646_12 euxassay_010646_13 euxassay_010646_14
EMAGE:15434 EMAGE:15434 EMAGE:15434 EMAGE:15434 EMAGE:15434
euxassay_010646_15 euxassay_010646_16 euxassay_010646_17 euxassay_010646_18 euxassay_010646_19
EMAGE:15434 EMAGE:15434
euxassay_010646_20 euxassay_010646_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15434Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15434_wholemount_strong.wlz
15434_wholemount_moderate.wlz
15434_wholemount_weak.wlz
15434_wholemount_possible.wlz
15434_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15434_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31170
Entity Detected:D8Ertd738e, DNA segment, Chr 8, ERATO Doi 738, expressed ( MGI:1289231)
Sequence:sense strand is shown

>T31170
CCAGGCGCAGAAACCTAAAAGCAAGGCTGCCGCGGCGGAGCGGAGCCGCGGGCCTCGGAAAGGCGGTCGA
GTCATCGCTCCCAAGAAGGCGCGCGTTGTTCAGCAGCAGAAGTTGAAGAAGAGTCTGGAAGTGGGGATCC
GGAAGAAGATTGAGCATGATGTGGTAATGAAGGCCAGCTCCAGCCTGCCTAAGAGGCTTGCACTGCTGAA
GGGAGCATCAAAGAAATCAGAAGCCACCATCCCTGGCAAGACACCATCCTGAAGGCACTGGGACTTTGCT
GGTCACCCCACAGGCTGGCTGGACTTGGAAGAGGGCCCTGCTCCAGTCCTGGTGGCCCCTGGAACAATGG
GCAGGTGATGGTAAAGCCAGGCTAGCTCCCAAGGGCTGAAGGGTGCTCAGCCTCCTCTGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4205912), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 53778. Forward Primer - name:053778_F_IRAV46_c06_D8Ertd738e, sequence:CCAGGCGCAGAAACCTAA; Reverse Primer - name:053778_R_SP6_IRAV46_c06_D8Ertd738e, sequence:AGCAGAGGAGGCTGAGCA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15435 same embryo
 EMAGE:15436 same embryo
 EMAGE:15439 same embryo
 EMAGE:15437 same embryo
 EMAGE:15438 same embryo
 EurExpress:euxassay_010646 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS