Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15439

Cyp51 cytochrome P450, family 51 ( MGI:106040)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15439 EMAGE:15439 EMAGE:15439 EMAGE:15439 EMAGE:15439
"Pseudo-wholemount" of euxassay_010645. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010645_01 euxassay_010645_02 euxassay_010645_03 euxassay_010645_04
EMAGE:15439 EMAGE:15439 EMAGE:15439 EMAGE:15439 EMAGE:15439
euxassay_010645_05 euxassay_010645_06 euxassay_010645_07 euxassay_010645_08 euxassay_010645_09
EMAGE:15439 EMAGE:15439 EMAGE:15439 EMAGE:15439 EMAGE:15439
euxassay_010645_10 euxassay_010645_11 euxassay_010645_12 euxassay_010645_13 euxassay_010645_14
EMAGE:15439 EMAGE:15439 EMAGE:15439 EMAGE:15439 EMAGE:15439
euxassay_010645_15 euxassay_010645_16 euxassay_010645_17 euxassay_010645_18 euxassay_010645_19
EMAGE:15439
euxassay_010645_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15439Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15439_wholemount_strong.wlz
15439_wholemount_moderate.wlz
15439_wholemount_weak.wlz
15439_wholemount_possible.wlz
15439_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15439_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
adrenal gland
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 06 07 08 14
brain
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
vibrissa
weak weak
regionalweak expression: see section 07 08
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 07 16
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 16 17 18
spinal cord
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 08 09 14
cervical ganglion
weak weak
regionalweak expression: see section 08
thoracic ganglion
weak weak
regionalweak expression: see section 10 11 12
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 weak expression: see section 09 13 14 15
neural retina
moderate moderate
regionalmoderate expression: see section 03 04 05
mandible
moderate moderate
regionalmoderate expression: see section 04 17 18 weak expression: see section 05 06 07 08 09 10 11 19 20
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 16
lower jaw molar
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 08
maxilla
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 07 08 09 10 19 20
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 13 14 16
upper jaw molar
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 08
testis
moderate moderate
regionalmoderate expression: see section 05 06 07 weak expression: see section 08 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31168
Entity Detected:Cyp51, cytochrome P450, family 51 ( MGI:106040)
Sequence:sense strand is shown

>T31168
GCTGCGCTGCTCTTCAATAGTAAAAACGAAGACCTGAATGCAGAAGAAGTCTACGGTCGGCTGACAACAC
CTGTGTTTGGGAAGGGAGTTGCATATGATGTGCCAAATGCAATTTTCTTGGAACAGAAGAAAATCATAAA
AAGTGGCCTTAACATAGCCCACTTTAAGCAGTATGTTCCTATCATTGAAAAAGAAGCAAAGGAATACTTT
CAAAGTTGGGGAGAAAGCGGAGAAAGAAATGTGTTTGAAGCACTGTCTGAGCTCATAATTTTGACAGCTA
GCCATTGTTTACATGGAAAGGAAATTAGAAGTCAACTCAACGAGAAGGTGGCTCAGCTGTACGCAGACCT
GGATGGAGGTTTTACCCACGCTGCCTGGCTATTGCCAGCTTGGCTGCCTCTGCCAAGTTTCAGGCGCAGG
GATAGAGCCCATCGAGAGATCAAGAATATTTTCTATAAGGCCATCCAGAAGCGCAGGCTGTCAAAAGAAC
CAGCTGAGGACATTCTTCAAACTTTACTAGATTCTACATACAAGGACGGGCGTCCTCTAACAGATGAGGA
GATATCAGGGATGCTCATCGGACTGCTGCTGGCTGGACAGCACACATCCTCCACCACCAGTGCCTGGATG
GGCTTCTTTCTGGCCAAAGATAAACCACTTCAAGAAAAATGCTACTTAGAACAGAAAGCAGTGTGTGGCG
AGGATCTGCCTCCTTTAACTTACGACCAGTTGAAGGATCTGAATTTACTTGATAGATGCATAAAAGAAAC
ACTAAGACTGAGGCCTCCAATAATGACCATGATGAGAATGGCCAAGACCCCTCAGACGGTGGCAGGGTAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4193738), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 53868. Forward Primer - name:053868_F_IRAV46_c01_Cyp51, sequence:GCTGCGCTGCTCTTCAAT; Reverse Primer - name:053868_R_SP6_IRAV46_c01_Cyp51, sequence:TGTACCCTGCCACCGTCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15435 same embryo
 EMAGE:15436 same embryo
 EMAGE:15434 same embryo
 EMAGE:15437 same embryo
 EMAGE:15438 same embryo
 EurExpress:euxassay_010645 same experiment
 MGI:4824180 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS